Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C55C2.4   

sjj_C55C2.4RNAiJA:C55C2.4
PCR_productsjj_C55C2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC55C2.4 Source_evidenceePCR682WS150 Sequence/Annotation Release
Overlaps_Gene C55C2.4 Source_evidenceePCR682WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598C55C2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI25585412560153
Overlaps_transcriptC55C2.4 Source_evidenceePCR682WS150 Sequence/Annotation Release
WB_DNA_textsjj_C55C2.41613agttatcagtagggtttcagggcctgactatttttcacatttttaagtaaatttataaatttctaattatcttatttcttactttcaacactttcagttgttcggactattttgagcaaaccgtggccacgttgaaccatttgaatcgatccagttactcagaagctattagccaagatttgttccaggtttaaagaaaaaattttaaaatgtgcctaactttgttatttccaggaatacattaagttgcgtaaaggtggactgacggaaattgtgatagagcaaattttgaatttgtactgccaggctaaaagacacttgccacaagcaatcaatagttggattcctccatcatttctgaacgggaattacacaggggatttgacaggagattctccatataatgtaagtgtgcaaaacctgaagccactctaaaaagagcaactcgttgtcagaaaattgcgaaagacagaaaattagaccaaataggttatgggaacatattcgaagtttgcggcaaatttgtcgaatttaccgtttgccgatctcgaccaatttgtcgattttgccgttttgtttgccttggcaaatttgtcgaatttaccgtttgccgatctcggcaagatcgccgaatttgccatttgttgatctcgacaaatttgccgaattcgccgttttgtttgccttgacgaatttgacgaatttgccgtttccaaaatttgccgtttgccgatctcgaccaatttgccgattttgccgttggccgagctcgtcatatatgccgaatttgccgctttccgagctcggcaaatatgccgaatttgccgtttgctgatctcggcaaaactgccgaatttgccgtttcccgatatcggcaaacttgccaaatttgcggtttgctgatctcggtaaatatgccaaatttcccgtttgccgacatcggcaaatttgcggaattcgccgtttgctgatcccgacaaatatgcggaatttgctgtttgccgggctcggcaaatatgccaaatttgccatttgctgatctcggcaaatttgccaaatttgccgaatttgccgcacaccactggcaaatatatttgttccaggacgattaccacctggcgaaaaacaagggagatgtgtttatggccgcctatcgaactcataaaaacaacaaattggctgaaaaactcaagacatccactgattttccatacaaatcggatttactcaagtaagttaatttcactttatagcacttgaacttcaatttctctttcagattctaccgtctatctgcctgtattgtacttttgagtctggcattgagtctgcaaaatgttctccgaattttctatgagaatcaggaagaggatgatgatgacgaagattatgatgatgaggaagaggatcagggaaatggtggatatgggttctacgctgaaatctacttgtgtgtggtctttggcctgtccttgatcactattttgatattgattaaggaacttgaaaaaatattatttctaatctacatgagccttctatttcgtaaaatatatcttcccagaaggtgaaattcaaaatctggagctgcggaaacaacatggatgtaaact