Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C55C2.5   

sjj_C55C2.5RNAiJA:C55C2.5
PCR_productsjj_C55C2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C55C2.5a Source_evidenceePCR997WS150 Sequence/Annotation Release
C55C2.5b Source_evidenceePCR997WS150 Sequence/Annotation Release
C55C2.5c Source_evidenceePCR480WS150 Sequence/Annotation Release
Overlaps_Gene C55C2.5 Source_evidenceePCR1054WS150 Sequence/Annotation Release
Chunk_score Abs_score931
Max_abs_score931C55C2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI25723212574617
Overlaps_transcript C55C2.5a Source_evidenceePCR997WS150 Sequence/Annotation Release
C55C2.5c Source_evidenceePCR1054WS150 Sequence/Annotation Release
C55C2.5b Source_evidenceePCR997WS150 Sequence/Annotation Release
WB_DNA_textsjj_C55C2.52297ggatttctaggccacttgagattttgatgaacttactgttaagagcaacaagccatcttgggaaaatcgccttgtgaatgaagacatagtacaagacgaatccgaaaagacaaatcgcgatagccagcgcagttgactggaactcatagaagattgggatgatgacaagagccacggtgatcgccaaaaacagatagatactgaaataactctaatttttatattctataaaagcttcagcttaacaaaccaaaaaagcggaactcgaaccgcgtcgggatgcaccggaatgtgattgtggcggatgatgaggagggcgacgagactgaagattctctgagcccagaagccgaacatcacgtaggtgatgagggtgtcgaggtccccgatgtaggagatcacaagcgcgaggacactctggaagaagtttatgtcagtggtgacgtggcatctggctgataagtagcctaggccatgggcgacgttacttcctacatggctgaggaatttaggcctcataggctcaaatccaggccatggggtgacaccttggaaccagtgtcctctaacaaatatctcgttaggtttcgcgctccactttaggctccaatgttagactgtttttagactaaatattaataatttacttcagctaaacatggtcgtaaatgatcctaggctattgatgacgtcacttcgtagatagttcggtagtagaaccatacatgacgccacaccttaactgaagaggagcaaagccaggggtggagggaaaacgatttttttaggcaaatcggcaaatcggcaaattgccggaattgaaatttccgacaaatcggcaaactgccggaattgaatttttcggaaaatcaacaaatcagcaaattgccggaattgaaaactcccggcaaatctgcaaaccggcaaattgctggaattgaaatttccgacaaatcggcaaattgccggagttgaattttttcgcaattcggcaaatcggcaaaattgccggaattgaaattttcggcaaatcggcaattttccggaatcgaaaacttccggaaaattgcgaatttgccgaaaattttcggaatgtggttttgcacatttttttggaaatttcagaattttaaatcgacaacattgaacgcaagatgctcatacatctattttggaaagtaagcaaattctatgaaaatatcaaattgccgagattgaaaacttcggcaaaccggcaatttgtcgaaaaaaatttgccgctgacttggtccatgtgaaaattttttcagttggaacagttgaaaaagtgctcaaaatttgtctgaaaattgaacattaccggttttttctggcaattttcaacttccagacttcagatagaggtttaatgccttagcccatatccatgaacttcaactaacctgcgctagaaccgccacccttggcgactctgtctctgtattgacacacgagaagcatgctggaagatgtccttgcctggccgccgcatacatgtacctgctgcccgagaagaggttgctgttcaacgatccgatgagcagaataccaatgagaaagggcacgacgttcgcaaaatcgccaagcgtctcacgactaaaaatctgaaattgagtagaaagtggactattgaattaagagagcctttaggaattgggtaccgcagcgactgcatccgattgtttcaccgtctccacgtcgagcaccacgaagtaggccacattgatcgccacgtagatcgccgtgacgacactgattccggtgagtagtgcaaagggcacgtttcgcttcggatgcttgatctctccggtactatagttgagcacgtcccacccggagaacgcccagagaccaccatagaatcctaggataaggttaccagttccgtattttgaaccttgcatcgggttttccaaatagccatgccatcctgaaagatagaatgagcgttaaactgcaaagtaaacttgcaaacctttcacgaaataaaaatagaagccggtcccgatgatgagcatacacgagaagagcttggcgattgttgcaagaatttgaaagcgagctgcaaacttgctcaactcaaagaagttcatccacgtgacgagaactgcaaaaaaaagaaagtgaaaaaatagcacaatgaaatcggatatgagagagggttgacaaaagaagatacttacataataacgaatacgcaaacaacttttggcacgtcggcacgagggcatcgtcgatttcgtagtactgaaaattggacaggctatagtggaggagtt