Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C56C10.8   

sjj_C56C10.8 RNAi JA:C56C10.8
Simmer:C56C10.8
PCR_productsjj_C56C10.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C56C10.8 Source_evidenceePCR577WS150 Sequence/Annotation Release
Chunk_score Abs_score472
Max_abs_score472C56C10.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII65878626588799
Overlaps_transcript C56C10.8.2 Source_evidenceePCR553WS150 Sequence/Annotation Release
C56C10.8.1 Source_evidenceePCR577WS150 Sequence/Annotation Release
WB_DNA_textsjj_C56C10.8938cgtaccgttcatctcacaaaactcgcgaattggtcgatgaaagggtagtgatttattgctcatcggctttcgtctcgttctttgaggcggcgtcgaagtctccaacaagttctgaaaaatgaacctgttatttaaaaaaaatcttttatgattttccaacctggcacatcttcgtcctctccctttccatctggtccgagcttggtaacgttgttggcaagtttcttgaggtgggtgagggactctggaccgagttggttgaggattcctgggagcatttcagtgatctctgcaaaatatgtaaggttaaaaacattcagccaatgagcaatacttacgcttgttatcggctgatcctgtgacagagaaggtattggctggaacagaggtttggacttttgggttgttgaagtggataacggttccatcgtccttaatcatgttgacctgaaaagttacagaaattaaattaatactttaaatcaaagtttacctcctcgattcctggaatgttggtgacagagagtttcttcaagttgctttgaagcttcttgtcatcggcagcagcggtcttgtggatgaccttcttctttctgcgtggagttccctgaaagaaataggagagataaaattataaatttaaatatttacctttcctccaattctgacatgctcctgttgagcttggagcttcttgattctctccgcaatagccttgctatccatttttggaaggattacctgaagacgaaaaatataattaaagacgtgaaaacgtgagaacaaaaaggataaagccagttaagaatatttattcctaaaataacaaagggacggggaaaatgcggacaaacgcgaaaaacggaaatgtaagtttatcaatcgaatcagttttagcctaaattcaggcacggaaacgaatacacctacgagatcga