Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_CC4.2   

sjj_CC4.2RNAiJA:CC4.2
PCR_productsjj_CC4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSCC4.2 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene CC4.2 Source_evidenceePCR635WS150 Sequence/Annotation Release
Chunk_score Abs_score551
Max_abs_score551CC4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1299385012995494
Overlaps_transcriptCC4.2 Source_evidenceePCR635WS150 Sequence/Annotation Release
WB_DNA_textsjj_CC4.21645gtatcacatctcgtgtccaatgacgcgaaataaaacggggaagcgaagaagtgcgtcaaacgaaattttccaattacaaagtgccaacaaactcgccaggcatcatgatgacatagacataaacatgtgtaggggggcccctcgttgatattgggatggctaggggggtcctggtggagggtgaaagggagacactacaaactacagaactgtgttagctgagcactatttgaattcaagacatataattctgtaatactgcatcaatagtatactaacttagttttttctacattatataatttaggcaaaactagttattttattaacatttaaaaaggttcaaatagtttttaattccagatgtccacagtggaaagtgcagctgtccgactacgtccagttggctcattgttcttcctgaatcgacctcacgagaaaagagcattcgattcgttagctggaagtggttttgataatggattcaacaaacgagcattcgacagtcttgctggttcaggtttcggagcattcaataaaagagcatttgattcattggtgagttgaaggtggccttaagccatcaggcgtgtgtgtctgcctactgcctaacttttttcggtgatcgattagaaaaagctgttccaaagttcgttaaaaatgtttaaaattttgaagcaaacatttttcaattgacgaatttttaaaaatatttctaacggtttttgagcaaagtccagatttttaacaatttttttcatgctacaaactacacttggtttcaaagtgtctcatttcggtttgatctacgcagatctacaaaaaatgcgggagaagtgacgcgtagttctcaactgattttgcatggttgagaatgtgctgacgtcacatttttctgcgcgaaaaatttccgcatttttgtagatcaaaccgtaataggacagcctggcaccacgtgcccatatggttaagctcttggtgaaaatgtagtttgtagtttgtagtttgtagtctttcctctccaaacaactccaaatttttcaggcgggaagtggcttcggtgcgttcaacaaacgcgcttttgactcgctagccggatccggcttcagcggttttgacaaaagagctttcgattcactggctggacaaggttttactggatttgagaaacgcgcctttgatacagtggtacggttttcggtggaaattccagtttttcgaattttcaataattttcagagcacgtcaggctttgacgatttcaaattgtgaagagctcactgatatttaaaatttggttcaattcaagcacatatttttgaggtaagcaactgattttaatgttgttaatcaaatgaaaagtgaaatttttggaataatttttttttgttttcaggtagctccaacgaacgacacacacaagcccagtcccccagtattcctgacgacagcccctgctcacacactttttattataattccttttttttcaaacttttttttcaaattttatactttaatctcaaaaaacctattcatacgaacacaagtaccggtgtgcgtgtgtgagaataagaatttattttaaaaaaataaagaatgtcgtcctgttttttcatatttattgaagaaaatggagctggaa