Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1007.10   

sjj_D1007.10RNAiJA:D1007.10
PCR_productsjj_D1007.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS D1007.10a Source_evidenceePCR762WS150 Sequence/Annotation Release
D1007.10b Source_evidenceePCR664WS150 Sequence/Annotation Release
Overlaps_Gene D1007.10 Source_evidenceePCR762WS150 Sequence/Annotation Release
Chunk_score Abs_score573
Max_abs_score573D1007.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI45872844589439
Overlaps_transcript D1007.10b Source_evidenceePCR664WS150 Sequence/Annotation Release
D1007.10c Source_evidenceePCR693WS150 Sequence/Annotation Release
D1007.10a Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1007.102156cgttgaaaagtgatttccttcagttttcacgggtttaaaatcgatttcaaactttttaattacgtatcaattgtaaagctaattaagggcaaggtggaaaaaaaagatttttgattttggttcaaaaataaaagcgctgatataaaaagaaaaaaccgctaaaaattgagtttttctcatatttcgtatatttatcatcatttttctagtggaatttgatgttcatttgaaaagtaatcttccaccaaggcttatattatgaaaaatatgaagaaaaacagtaaattgaaacgttttcggtaatttctcaattttgcacgcgatgcacgagaagtgcgccaacaaaccgatttccactggaggagactgtgtcgcgtcgaatacgttgtgtaatgtgcattttcagaatttagtgttcccgtaatatttaaagtgtaaataaatcggtaaatatttccatttcagtaaacactacatcgacttcggtgaatacgttcgtgatacttttgcccttcgttctcgatgcaccgatttgacattattcgcttgttggtactgtttcattgcaatctgccacgtggcaacgaacacaattttcagtcgatatgtcaaggtttcagaaaaagaaaaacaaaatgttttttaattcagttcattttcagacgatacatctagttcaaaggccgttaaaaactagaatacgaggccaagccgtgtttcttgtgcaatttttcacgatgaattctatcgcagcactcgctgcaatactttttggagccgctggacttagcttcatgtttattcactttaattatgcagctattttgtttttggaggtaattctgcaaggaaacgggagacagaataactatcaaatctgaatcagggttgtggtttttttggcaaaaaattatttttttggtgtttttcgtccaaaaaacaaaaagtgagggtcctgattttaattaatccggaaattcaatgaaaaatattaattaaaatttattcagagctatcgagtatttgttcgatccttatttgtgctcggtcggctatcagtaagcacttcaactgctcgaatgaatgatattgaagaacaggtgattttgatattaaataaagaatttttgaaggtcttcaagccaaatttagcaattttttcgccgatccggtcttgacacgacaatttttgttaaattaaattgggtgcacctttaaagattactgtaatttcaaacttcagtggctttggaattttcttcgtttttttcatatttttttctttaaagtatattcaattattgagagaaaaaacagtaaaaacacataaattttaaaaagtcgatgaaaattccaatgtttgaaactacagtactttttcaaggtgcacacccttttacatttaacaaaattgtcgtggggagaccgtgtaccggaggaaaaattttgccaaaaatatttgaaaattaaatttttttaaataatcaaacattttaattttttttttccagaaacacttatcagacgaagagattactgatttgattgtgaacagccagaaaagaattggaaaatatttgaatttccggaatatctacataacctctacggttttcgtcacttttcttctcaatattttatatgcggtaagacattaagtcagaaatcattgaaaaatgtgatttttccggaaaagtaacggttttttcaaacgaaaattatgggttatctagaaatttgcactgtgcaggaaaaatttagttttttaactcgaaaaaccacttgtatttatagaagaaagatggcaatgaagcttagtacaattcaatttttgcaataattaatttttttgcaataaaataattttttggtggaaagcaaaacacagtcttgggtctcaccccgaaaataagattaacattgtcaaacttttgaaattcaagatttctttttccagatcacgggtctcttgattaatcgaaaaatgcttgccttcggattcgcgatcggagccaaccaagttatcgatgatattcttaacgggagagaatacggttcgaccgaattattgtaaattatttgtgtatgttgtatataaacaatttgactatatttattgaaatgattttgttattcaagatccaagagaagcagac