Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1007.2   

sjj_D1007.2RNAiJA:D1007.2
PCR_productsjj_D1007.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD1007.2 Source_evidenceePCR794WS150 Sequence/Annotation Release
Overlaps_Gene D1007.2 Source_evidenceePCR794WS150 Sequence/Annotation Release
Chunk_score Abs_score690
Max_abs_score690D1007.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI45717244572852
Overlaps_transcriptD1007.2 Source_evidenceePCR794WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1007.21129ccattcaatccattcttgccagatcgtccactaggaccaatgatcccggtgttgtaaactaaaaatttattagcattgatgtcagttcaaactcgcgcgcaaataatccgaccaatcaacgacgccgggcacgcccgctgctcgtcggtgattggtcggcgctcttctttgatatcaaggagatttccaacaacaaaacaagtaactcactaaatcccgcatttccctgtgctccttgatatccttttcgtccagctcttccacgtggccccggtagaccaatatatcgatttttattatttccaggtggcccaactggtccaactggtccaggaaatcccgggtaaccttgccatccaacctccccagttggcccgggtaatccaatcaccgctttcaccgatattccatttttcccgtcttttcccttctttcctcgtttcccccttttgccacgtggccccggtttcccgatatggcattgaatacatccatttgcaacaagaacactgattccagagaacccgttagtcccgttaactccaggttcacctggtattccgtcttttcctggttttccagggatgcctggtgggccttctggacaatttttactttttcgttggcaatctggaaatttttcatattaggtcaagtggtatcccgtggcatctcaaatgaaatatttttacttccattaatacctgccaaacatatctccaaataattcttctttttctccaacttctttcgacttttcaccaatttctcctttttcctcacatccaccccatttatagaacccagtgagcttccatcaactgccgcaaccgcatctggaagatgatgttctgatgctagaacgcctgaaaaggtttcataaatgaatcataaaatttcagcattttctgcctactttgataggtgtccgcaggaaccatcttctggacataaagagttggatcgtactgttgggttctgtacgaagtggcaaaacgccggaatcttcgatgagttttcagaaggttaatctcgttccaagcttcatttgaggcatactgaaaagttatgagagtgggagttctgtcaaaatatacacaaccttttttttatttttcaaaccagccgc