Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1037.5   

sjj_D1037.5RNAiJA:D1037.5
PCR_productsjj_D1037.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD1037.5 Source_evidenceePCR775WS150 Sequence/Annotation Release
Overlaps_Gene D1037.5 Source_evidenceePCR775WS150 Sequence/Annotation Release
Chunk_score Abs_score712
Max_abs_score712D1037.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI36909523692584
Overlaps_transcriptD1037.5 Source_evidenceePCR775WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1037.51633tcacaagaacatgcaacaaattccgagtgcttgcaaatgctttatagcaagatttggcaaattggatcgggtttttctgaaaaaaagtaatacaatttcccattaaaaaagtatcggtctttaactcttcaactttgttattttgacattttagattttttttccaaagttcgtcaactattatgttttaaatttaatttaaaaccagctgaaaaaaaaatgtgcggcgctcttgcaaatttctcgtaaaaggacgtgtaaaagggcgtactaaccgcatgcgccacaatcaaatcgattccatcaatcttttccgttggaaatactcctgttccaagtgaaatgacacatccaatcttccagtttccacggttttctcgttcagatgagcttttcgcaaacgatttttcaagtttattcgtgaggaagaaatcagagatcagtgcaagcgtcggattgttcgcaatcaaaccaccatcagaaagcccattgaatgactcgaagaagtatggagccgcgctgaaaattttttttttatatttcaaaaaaaactagagtcgtacgttgtgcatctcagagtcttccacagctcaaccttcgttggatccaggaacttatagtgttcacacgcttcctctggcatttctggacgataggatcggaagaggagaagttgaggtggaaccattcgagtatcagctacagtaacaattgctcggtgtcttttgatactcgacattttcgaatcttcccaagttgtgacgtggcgggcgatgtactccataccgtttgaactatattttggaacggctttgtcagctccacggatgaaaactcgatcacgcatatctagaagtagctttcgggtttcttcaatgtttcgatctgaatttaaaataaggtgatatgtaggcacgtaggcaaaaaggcacagtagccttattgccttccaagttttctgaaactcgtactcaaaggcgctttcggatgggtctcgccgcgataaaaagttaacaaagtttaattattacggagacactaaattctgataatgcgtattgcgcaatatacttgacgagcaaatatctcgtagcgaaaactacagtaattttttacattactactgtaacgctggtgtctttgctttctcgtttttttaaattattttaccgtaaatcgacaccagctcgtagtaaagaggtactgtagttttcgctaagagatatttgctcgtcaaatatattgcatagtacgcattctcggattttagttttcccgtaatagtaaaaagcgacagccaaaaagataactactaccataaatttttttcgtggcgagacccaaatcgatgttccttctagtacgagttttagaaaatatcaaaactacgatatctcagtagtttaaaaactatcaaacccaactgttagttgataaaagaagagtgataacacctccacaactggttccagcaatatcatcaagcttctcgacgagctttccaccgagcaaataatcaatatgaatgagcatttgtatcgtgataacagctcgaattccgcctccgtcaagtgccaaaagaactcgttcttcaggtttccactgcttcttctcacttgccaacacattattg