Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1054.14   

sjj_D1054.14 RNAi JA:D1054.14
Simmer:D1054.14
PF:GL1_3E2
PCR_productsjj_D1054.14
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene D1054.14 Source_evidenceePCR796WS150 Sequence/Annotation Release
Chunk_score Abs_score718
Max_abs_score718D1054.14
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1080748310808508
Overlaps_transcript D1054.14.2 Source_evidenceePCR796WS150 Sequence/Annotation Release
D1054.14.1 Source_evidenceePCR796WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1054.141026gatttcgcgttcttcatcgttgtctgcaccacctcgacgagattcttttttcttatcacgacgatcatcatctgcaaatataaattattcatgacatggtacctttaaaaacatacattgacaacataattttttctggttaatctaaatgaacatgcttgactatatctataaaaccaaaataaaatctgggattattcagatttccgtgaagtttttatcagaaaaccatagaatgtttgattaaaaatattacctcttctatctcgacgatctctatcccggcttctatcacgatctcttcttctgtcatctctatcatcacgtctaccactaccactactgcttggccctggctcatcgtctcctctttctcttcgttctttcagtttttctcgttcacgaacttctcgtcgatcaccaacatctctttcgcgatctctgcttcgactacgtcttctagatgtcaaacgtggcttctccttctttgtgacttcttcctcttcagaatcagaatcactcattgcaacaagatcaccatcaagaagtgacttatatgacggaagcatgtctacttcttcaagagcccatctcttctgtagacgaggaagttgaatgtcacaatagcgatcttcacgaagtaaattgtcgatgaaatcgtccatgtagatagcttcgaatcgacccatcttattcatatatcttaatttacgaaaatcattatataatggttcgagatacttgtaaatttcggttgaatcaaatgtaagtcgaagatacattgctcctagagctctgatatacttgaattcctcttgttgaatgaattcaagaacgatatccttgtccggctgaatttgtagcatcttgagagcgaggcacaaaaaaggagttggtttgatgtttcctgcgtagatacctccgatgtatcgaagatccattcccttgtccacgaccagttcagctaaaaaaataatgttaaattagtgaatagcaaagaacaacttacctgtgagcgcaaaacag