Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1054.5   

sjj_D1054.5RNAiJA:D1054.5
PCR_productsjj_D1054.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD1054.5 Source_evidenceePCR895WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcriptD1054.5 Source_evidenceePCR895WS150 Sequence/Annotation Release
Overlaps_pseudogene D1054.4 Source_evidenceePCR1005WS150 Sequence/Annotation Release
Map_statusBest_ePCRV1077548810778271
WB_DNA_textsjj_D1054.52784acgcttgataactgctttgtctctggaggtgtataatttttcataaccattatgtggttccggatctgttggatctgtggattgtgagctcgtatctgattcaaatggaagaaaagcttgtgatagtgatggacgtttcttatttgtcatttccaatctgatggtattcattgtctcggtcttggcgacctttccagctatttgttcgatccatttctccgtttcgtttttctgctggctccactgttgttttacttgatcctgaaacgttatattactcaattgaagataatagctctgatcacctgaatataggattcaatgtcttctgcatgcctcctcatctcttcaagagacatatctttcaaatccggatcttcaacagaaacagtttgcacttcagtgtaatctagctgaaaagagcattctggatggacaatcgtgttgtggcatcgcgtgaagctcaatggtgctggtggagcacgatttggcggtggaggtggtgtacgatcatcgcccaaacgaatctcgacattgcattgtgcactagatgaacccggaaattgattcgatgacggtgagaacgatatcgtgtcatatttatgacttccctgtggtcggagagcagattcagaacgattacgaccatttgcggagagaatcggaggcgaaaaaagttgttccacacttgtagactgtaaacaggaaggaatgttatttattattttgttgtggacttaagtgtactttaaaaacattacaatattcggtatggaacgtaaatattctgtaaaatacaaaactgttcaaatttacaattcttctaatttcgtactaacaaatttgataatacatttgagaagtgtcacgtcacactgtaaaaaggttactgtggcttgcgtcgatttatggtattgcatcatccttttcaacaaaaaacatgaaaggtagcatacaaataatctcatatgtagtaatagctatacttactattatcaggttgtcccataagtttttgtactttttttcaaatatttttccaaaacttctagaaagttttaaaattttttcatcgtaggtcgtgtcaaggtcgggtcgtcccctttcagaaaagattcatttcatccatttctactttgccacgatgacaatcatcaaacttgaacgtcgagacgttagattgcttcttctttatgaatttcgtcttggtcattcagcaatggaagcggaacgaaacatatgcggtgcgatgggtgagggagcactctcttataatacagcaaagagttggtttcaaaagttcaagaacggcgacttcagtctcgaagaaatagaacgttctgggcgaccggtagagttaaatgaagaagacctagtgaagctggtggaggaagagcctcgtcttagtcttcgtgaaatggaagagaagcttgagtgttgtcatagcacaattgcacgtcacttgggtcgccttggttttacttcaaaacttggaacttgggtgcctcatgaactttcggcatcacagaagctcactcgggtcaacgtttgtactcaacttctaacttttcgtcgaaagttcgattggctgaacaatctggttactggagatgagaagtgggtgctctatgttaaccattccagaaaacgtcaatggcttccgatcggtgagaaaggaataccgacgccaaagcccaaaaaagattatgatctgtgtctggtggggtgttcaaggacccgtgcactgggaattgttgccaactaataaaactatcactgctgattactattgtgcccaattggaccgagttgcagaaaagaccaacggaaaatatgaaaaactatattttcttcacgataatgctaggcctcatgtcgccaagaagactttccaaaagctgcaagatcttggttggactgttttaccgcatccaccatattctccagatcttgcaccaaccgactaccatttgttcttgtctctcagtgactacatgcgcgacaagcaattcgacgacgaagagcatctcaaaactgaactctccactttcttctcatcgcgttcgccggatttcttctcccgtggcatcatgatgttacctagtaaatggcaacaagtggtggacactaatggtgaatacttgtgtgaatagtactacttgtcgcttgagagaaataaatttttttcaaaaaaaaaatagtacaaaaacttatgggacaacctgatagaaatactacttaaaccttaccatttaatcaatcaaaaacgtaagatttctaaaataaaaataaccacataaatcgacactagcttcagtaactagctgtccccgtggtgagaccaattcgcttgagatagggcgaaaaatcccattgcatacgtaatacaatatacattggagatttcaaagttaaacatgtacatacccgatagcttgagccttgttccccataactggtcatattattctgtgaggattgccactgaaaacgtggaatgttcgattggtgtttagctccaaagccggctggcaatgttttatattgactcggtgagactccagttggtgatgacaatggaaggggggtacgttctggaaataagttggtatcgtaccagtcactatgttgtttacagtttaatttttttattttcgctgaaactaatgagctaatacttttaatactattagttttacataattacctccaattgatcgaatgctatctggtgccaggtacgtctgagaatcagtgggcaaaactgatgatgatggaggagaa