Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1081.4   

sjj_D1081.4 RNAi (5)
PCR_productsjj_D1081.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD1081.4 Source_evidenceePCR856WS150 Sequence/Annotation Release
Overlaps_Gene D1081.4 Source_evidenceePCR856WS150 Sequence/Annotation Release
Chunk_score Abs_score730
Max_abs_score730D1081.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI84740898476521
Overlaps_transcriptD1081.4 Source_evidenceePCR856WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1081.42433ttctagaacatttaatcgcgagcgcaatgctcaacaattttataaatacggtatggatcattggcatcagtcttccttgccttaatatccatcgcaattttgtgaagactgttggtgtaactcttgcaagtagtattttgaataaattccatttccatgtttgaatgaattgagttatcttcgggatcacgtggcaaaacgactgatgaatcgacgtggcagttgattaaagcatgcgacattccccaaaaacgaactctgaagtatcgatttccagatagacgttccactgtgaagcatggttggaaatacatatcactggcaagaagttgaccaattctttccctgaaacagttgagcttaattttgaaaatggtcaagttttaagccagaaagttttgtaaataatcatactttgctggattggcaaccggctgaggtgtgttgaaaattgtttcccagttctctttgaagtaaaaagtgaattggtttttgttagacaaatcatagtttttatcctgaacttcgtttttcgtaaccttttatagattgtgtagatgttacctcagaatgagcagaagaaataattgtagcggcaatgctaagaaagccgataaaatgtccagcgaacttcatatttcccaatggaaaagttgaactgaaaaagttgtgttcttattttttgggaaacattccacgtgaattatgattttgtaagaaagtttttcacgtaaactgaaatttaaaaaatcgaataaaaaactttatgaaaaacaaattaaagtccgtttaactaattatacaatgttccttctgttgtctcctcgcactttttattttctcaatatctttcggttcgacgccactgtaacctcgacttgacggcattgattgactgaaatatgtttaaaaattgtatttggaagatgacattttgggtttcttactacatcagttgatgagaaaactacatgaacttattttgaagatttctcaattttttaaaaagacttaattaaagccaattacatggtgctaaaacaactgaatatcatgttaaaacttttcaagcaattctggttattcctcctttctctcgtttaggacgaagacataattatttcaaatcaaaaagggatgaaaactgagtgcgcgccacttatggagaaatcaaaagcactgtcgcgtgtagagacaattttgaaatatgaataaacataatttgagcataaaactgatacttgattattttataaatttagcaatataggctgtttttaatcattttttccaaaagccgtagttcaactttgaaagggtaaacgtgtttactcaccgtcgtttcctcaactcaaatccttgaatgttcaaattaggtctcgttcggagtaatatttcatgaaaacacgctctgacttcttcttccctcaatgcacagcattccatattagattttgaggcacagcatgaaagacatggtttgtcggttttattggctaccagaagcacaggtaccttcaaaaattaaatggtgaattattattgcagtaataaagaaacatacactattccctctccttgcatgaatatctgacagtgtcgataatgcttcttccagtgaagaagcatcgtccgctgcaaatacaacctgaaatacaaacagattacagttgaaacaactgatatctgaactaacaagaaaagcatcagcagtaccaatatacaagtttttcattccaataaaatcacgcgacccgcttgagtcgataatctggaaaatgtttatacagtattagatgggctccagtgctgtgaaaaattcggctgaagccgccagccgagtcactttctttcggctgccggctcaagcgtaatcaaaatgaagttttcctatatattgattgcttggtaaatcatacctgaaccattaaaactcttccttcttcaatttcatattcaatccaattaaattcttcgacagttggacgatagtcctccacaaatttatgccataaaaattgtgaaaccatcgctgatttaccaacctagatatttaattttcaaattaaaaaatttacgaaataactaactctttctgctcccaaaactgcaaccgtaaccttattctgccgtcgatcaccccgtggttttgcatctcgacgacccacacttttgctgcgattcatctgaaaatataatgcatttttaaaaagaagttttaaattttaatcgaattgaaaagatctttttaataaaaaaaaagtacataaaaacatcaattcatttttcattcgaatatccaattcaaaagttctcgtgactgaaaaaaattctcacgaaaaacagaaaagttcgttggtgtgagagatctggctctcttacataattactcatttccctcttttcattttcttggtttttgcaatttctgat