Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1081.5   

sjj_D1081.5RNAiJA:D1081.5
PCR_productsjj_D1081.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD1081.5 Source_evidenceePCR747WS150 Sequence/Annotation Release
Overlaps_Gene D1081.5 Source_evidenceePCR747WS150 Sequence/Annotation Release
Chunk_score Abs_score663
Max_abs_score663D1081.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI84813278482431
Overlaps_transcriptD1081.5 Source_evidenceePCR747WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1081.51105atttcctcccagttctcggtgtcaaatcaattgaaatggcaattggccaaatggaagagtacttggaaatgcttaaaaatctgagagtcgattacgaaaaagagccaaatcttcagtcctgtatgtctccaagactgaatgactcaatgctcattcatcgtaatcgtctcgctcgcacctcaaaatctcgacttgcactataccgtacttcacctgaaattgcacggttctcgagaggatctccggacgatattgaaaatgagaacttgtctatgtcgaaaattaggtcaattaccgaggagacatcaattttagatccgacgctttgtatggatgagacgacggtgagcctgctgaattagaacgatattttacccgggcgccttctctctctctctctaacccgtctgtggatgttcttccggcaaatccgactagacatcccgccaggatgagatgtgatgagggcgtctcacccgccttttccctcgccctctgcgtctgcttcgttaatccaaactaatgataaagcgaaatttgaatggattatacaatattttatttacattagcttaaaaacaagtatgacgttgtgatatatctattccagcatcaaagaggatttctggcagatgtgagcgatatgaatggaactgtccgttctcgaatgcccagtttcaattttaatcacatatctcctgtacctgctgagaaaacacgtcgacactctgttctgaatgtcacaaccgactttgacgtggatctttcttcattatgtgagccaagtcaaattgaggaaaattctggacagattttgtttcaaaatgtactggagtctgcgttgcgtactccgtaagttttaaaatgttgtgttgtttttcaattagaaaagagtttagaaacgcaaacaataatacaattcttctaaccgattccgaagtgacacctgtgaatatttctaacttgtggaatgtgaagcttcgtccagggagcaatcgaaaggtaaaacactattttcagagaaaaaaaaattggaaaacgttgcagattgacaacgggatcagaaaggaaatccagaggcaattggcttgtgactcccaattgt