Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1081.7   

sjj_D1081.7 RNAi JA:D1081.7
PF:GL1_3E1
PCR_productsjj_D1081.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene D1081.7 Source_evidenceePCR1107WS150 Sequence/Annotation Release
Chunk_score Abs_score1044
Max_abs_score1044D1081.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI84892378490432
Overlaps_transcript D1081.7.1 Source_evidenceePCR1107WS150 Sequence/Annotation Release
D1081.7.2 Source_evidenceePCR1107WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1081.71196tcgcaatcattcagtgcttcgtcatcgtacgatcaagcctcgcaatccaacacaaaatcttgctgaagtcgtaaaaactcatggtagcattccttatgaagcgctttcggattgtgataagattatcgtcgacttaggaaagaacattttcaaagtttatgcaactcaacctggagaaatgatggtccgcctttgtgatccccacgttgacacgactacattgccactcctagagaacaatcttcgggatcctgtcgagtctgatttacgttggatgacactgggaaattcccatatcaagaaacaatctgttaaagtggtcaagcctgcaatgtttattgcgccacgcggatttttgttgattttaaaagatgaagaacgtgaagaaatggacgttgaaaaggttgctactatggggaatatattgcgggccgtgatggtagcgcctattgtggagctccagcgtgaaaccgtccgcacgggatcagctgcagtctacgtttatcgacaaggagcggaggtgcgctattatagagtgttgatagttggacaagctaaacaagatggtgaagtgttggttttgttggctgatgtcgatgatcaatatttcgtggatgtacatctatctcatttgttcccgattccggaagaagccagcttcaaacactttccctcgaatgttgtattcgcaacattgcatggagtactgggtttgacgctttctgagcaggatgtgatgttcgaaaacattgataatgatgatacaaaacgatttgtgggtggatattttcatggaaacgatgacgtgagtttacagatggttgtttagaaatttgtttaatgtttgcagagaattcttaacatcgatatggtttggaaaaatgagcgtggtcaatttgagtggctttcacaaattgtcaagagacgtggagcagttacttcgtccgatgccaacatcattcactttccacattctgcactcgatgtgataaagtctgttggaccagattgttcggtgtgctttgtcgactattcagttcgtgatgaatctgcaacatcttcattgatggaatcgactagaattgttcatgatagtcgtggtttgtgtcaaaatcgttagattttaaaatcattttcgtttcagaatctatgacaactacttatgttggtgagatgccaagcccaattatcgaaga