Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2024.8   

sjj_D2024.8 RNAi (4)
PCR_productsjj_D2024.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2024.8 Source_evidenceePCR853WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcriptD2024.8 Source_evidenceePCR853WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2024.81023aaactcctccgtcgatagcacaatactttggacagattcccttctctccggcacctcctccagatcctggtggtccatttggtcctgattctccgcttgctcctggtggcccatctggtccattttgtcccttggctcctcccattcctggaattccatctggtccagccattcctggtggtcctggtggtcctggaattccagaatctcctggcggtcctggatctcctggaactggggatccttcttgtggtgcgtcttttcctggttctcctggcattcctggctgtccatcggctcctggctgtcctggtggtccctttggtcctggttctccatttggtccatctggaccgttacggcctggctgaccagccggtcctttatctcccggtgctcctgaaattgacactttgcaaaaaaatatttctactttcaatttaccagttactccttgctctccaggcattccaactggacagactctgcaaggcggtggtgatgcagcttcacatggtgcttgaattgttgtctttcctggaacacctggcagtcctggtgctcccggctttcctggacgtcctggctttcctggttttccatttggaccaggtcctcctggacaacatccctttaaattgaacagcattttgcaaatgattcaagaatttcaaacttactccacaagatcctccaccagcagcttcaataactggaggtgcttcactatatttttctccaccacctccacctccagctggtgcagcatccttgtaagcggcttgtcttgggaatcgagatgttctgtttgtgaagggcaagttcttcatgatctcaacctcacgccaaatttctctagcatgatcctgaaggaaaaatttgaaagtaattgaaaatttattcacatattcacatattattcacatggttcattaatcttacctcacaagagacaacttcagtattaatgagctgcttgacatggaacatgtacatataaattgcaggcatcgacacacatac