Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2024.8   

sjj_D2024.8 RNAi (4)
PCR_productsjj_D2024.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2024.8 Source_evidenceePCR853WS150 Sequence/Annotation Release
Overlaps_Gene D2024.8 Source_evidenceePCR853WS150 Sequence/Annotation Release
Chunk_score Abs_score748
Max_abs_score748D2024.8
Specificity_index0.47
Rel_score1
Map_statusUnique_ePCRIV72455157246537
F36A4.10 Chunk_score Abs_score101
Specificity_index0.063
Rel_score0.135
T21B4.2 Chunk_score Abs_score126
Specificity_index0.079
Rel_score0.168
F30B5.1 Chunk_score Abs_score386
Specificity_index0.242
Rel_score0.516
ZK1290.3 Chunk_score Abs_score231
Specificity_index0.145
Rel_score0.309
Overlaps_transcriptD2024.8 Source_evidenceePCR853WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2024.81023aaactcctccgtcgatagcacaatactttggacagattcccttctctccggcacctcctccagatcctggtggtccatttggtcctgattctccgcttgctcctggtggcccatctggtccattttgtcccttggctcctcccattcctggaattccatctggtccagccattcctggtggtcctggtggtcctggaattccagaatctcctggcggtcctggatctcctggaactggggatccttcttgtggtgcgtcttttcctggttctcctggcattcctggctgtccatcggctcctggctgtcctggtggtccctttggtcctggttctccatttggtccatctggaccgttacggcctggctgaccagccggtcctttatctcccggtgctcctgaaattgacactttgcaaaaaaatatttctactttcaatttaccagttactccttgctctccaggcattccaactggacagactctgcaaggcggtggtgatgcagcttcacatggtgcttgaattgttgtctttcctggaacacctggcagtcctggtgctcccggctttcctggacgtcctggctttcctggttttccatttggaccaggtcctcctggacaacatccctttaaattgaacagcattttgcaaatgattcaagaatttcaaacttactccacaagatcctccaccagcagcttcaataactggaggtgcttcactatatttttctccaccacctccacctccagctggtgcagcatccttgtaagcggcttgtcttgggaatcgagatgttctgtttgtgaagggcaagttcttcatgatctcaacctcacgccaaatttctctagcatgatcctgaaggaaaaatttgaaagtaattgaaaatttattcacatattcacatattattcacatggttcattaatcttacctcacaagagacaacttcagtattaatgagctgcttgacatggaacatgtacatataaattgcaggcatcgacacacatac