Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2062.10   

sjj_D2062.10 RNAi (5)
PCR_productsjj_D2062.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene D2062.9 Chunk_score Abs_score209
Max_abs_score209D2062.9
Specificity_index0.672
Rel_score1
ZK1236.6 Chunk_score Abs_score102
Specificity_index0.328
Rel_score0.488
Overlaps_pseudogene D2062.10 Source_evidenceePCR658WS150 Sequence/Annotation Release
Map_statusUnique_ePCRII26064172607548
WB_DNA_textsjj_D2062.101132acattttgaagacaaggcaaaaaagaatatcaaaggatttaagaggagaacatgtgatcatatatatataaaccagccgtgggccgcacctacggcgcggcccccgacttttttgagaaaacacattagatatacggtgtctatcgcggacctcgatcgatgtctgctgcgcatttagcataaggtttcccaaaatttcgttgctctgatcagagatcaatctacatagaaacagaaggacacgcgctttatatatagtaagtgatatatatatatatatatatatatataatgatacaacaacaacaaaaactagaaaacaactatgtgtaatgctcgaaattctgagtttgcatattcaaagtcccatcgaagaaatggcaagatttatgttcacttttgttctaaaaaacagttgttgtagaactaaataggtaacttggtagacgactgcaattgtctcccactcacttttttaaaccctttgcaataatcttgcgatatggcgggaaaaatataaatagagaaaccatattaattgatgaatgacttgcgaaccaagcgaatattaattcagatatgaaattcatttgtggaatttcgaaaactaagatcagaacctgtatcatcggacccgccatacacaacactgcggttataaactgaatgatcacacttctcagtgcttcattgtgcttttcatatgttagttttgatattcgaagcttcaaatgagacatcatgcgtacaatatcatatatagataaacaaaggaataagaacccaaaacttgcaactagaaaaagtgccacaataaatattatagtattctgtgattttacatagaccacaaaatttggcaggttcgagaactgtatataaccttgcggatagacctgtaaaacgcttataattttgatttgacagtacctctttgattcttacctccttgatatatatcaacgcattttcccgactgagactaagggaattcaaacatgcgcagatgaaaaatggaaaaatcaggcaaagtacgtataacgcgtttattacgcattttgacagaatatgtttgttcaatagaattgcaactccttgatgcttcttcacgaaacacatgattaagctttcc