Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2089.1   

sjj_D2089.1 RNAi JA:D2089.1
Simmer:D2089.1
PCR_productsjj_D2089.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS D2089.1a Source_evidenceePCR737WS150 Sequence/Annotation Release
D2089.2 Source_evidenceePCR332WS150 Sequence/Annotation Release
Overlaps_Gene D2089.1 Source_evidenceePCR737WS150 Sequence/Annotation Release
Chunk_score Abs_score716
Max_abs_score716D2089.1
Specificity_index0.266
Rel_score0.363
Map_statusBest_ePCRII1066049810661980
D2089.2 Source_evidenceePCR332WS150 Sequence/Annotation Release
Chunk_score Abs_score248
Specificity_index0.734
Rel_score1
Map_statusBottom50_percentile_ePCRII1066049810661980
Overlaps_transcript D2089.2 Source_evidenceePCR332WS150 Sequence/Annotation Release
D2089.1a Source_evidenceePCR737WS150 Sequence/Annotation Release
D2089.1b.2 Source_evidenceePCR111WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2089.11483acccacgcaagagtacatccgaattccatatagtcttcgagctgttccgaaagtggtctcggcagagtaattttgttccaatctttcaatcctgccggaatcaactcaaacatatcctgacatatggtacattgaatgtttgatgttgtacggacccattgctccaagcatccattgtgaacgtaggcgactgttccgctacaagagcatggcttgatcagactgtcggaactctagaaatatattgctaaattagaaattgaaaagaaaaattaccgtatcgttatcgaaacatattctgcagattacggtttttgtagaaacttccttcggtgaccgaatagtttctaagtttctctcgattattgtgcacataatttcaaaacgagtagaaagtttgcaaccgacaatttagaaatgaattagaaatttgaaaaaaatacaacatttgtatttaacaaaattaaatatattttcacgtttcaggtaatgtacgccagaatggcctcgggaccggatgcattgccgtgtgcatatgcttatgttgaattctcacagcaagcgtcagtgtgcaatgcacttcaaaacgatggattcgagtttaaggagagaccattgaagtgagtttaaagttttaatttttttaaaggttaatggtgattttctcaaattcagaaaaaaaaaccataaaagaaaaacaaaaaaaaatattttgacacaattttggctaattttccgccgtttttcttttatggttgtctgttttttaatttttaatttttttaaaaattaaaaaccccgtccacgcgattctacctttaaaataagtcaactaaattttaaaacttttaaatccaataattaaaatatttttcttcagaattcaacactctcgcgttgccatcatcaaaccacaagccaaaacagacgaacaagctcttggagaaatcgaggaagcgattcggatgggtagaaacggagatgatcgggatcggcgccgttcgcgatcaccacgtcgtcgtcgttcgccgtcaccgcgtcgcagacgggatagtcgtgatcgtgaccgtgacagagatcgtgacagaaggcgaagtcgcgaccgaagatctagaagtcgtgatcgtgaccgtgatcgtgacaggaagagaagccgtagcagagatcgtaaacgccgcagtcgcagtcgtgacaacaaggatcgtgataggaaacggtcgagaagcagagatcgcagaagacgttccaaatctcgtgatcgtaaacgtgaaaggtctcgttcaagatccaaagatcgaaagcgtgacaagaagcgcagtcgaagcagatcacctgaaaaacgacgtgataaggaagatagaaaaaccgagaagaaagaaaacgagaatgaatcttcgctacgtgagaagcttctcgagaaaaaggccgcccggaaagactcttctgatgatgaatgggaggaaaagccaacaccgactaatgg