Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2089.2   

sjj_D2089.2 RNAi (8)
PCR_productsjj_D2089.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS D2089.1a Source_evidenceePCR177WS150 Sequence/Annotation Release
D2089.2 Source_evidenceePCR543WS150 Sequence/Annotation Release
Overlaps_Gene D2089.1 Source_evidenceePCR177WS150 Sequence/Annotation Release
Chunk_score Abs_score131
Specificity_index0.171
Rel_score0.207
Map_statusBottom50_percentile_ePCRII1065980910660909
D2089.2 Source_evidenceePCR543WS150 Sequence/Annotation Release
Chunk_score Abs_score459
Max_abs_score459D2089.2
Specificity_index0.829
Rel_score1
Map_statusBest_ePCRII1065980910660909
Overlaps_transcript (5)
WB_DNA_textsjj_D2089.21101tcagtgtatcctcgccaatctatgctgcgcatcgtcggatatgaaagcaattaaatttagaaattttcaaattcctgatattttagaaattgcaatatttctagttttcgcgccgtctaattattccatttttcagttgattacagtcgatccgacactggagcagctcggactaccggcttatccacctctaccggctgacacggattctgccaaagtcgaagaaattcgaagaacagtctacgttggaaatcttccgaaaggtgttgatggaaacgaggttctcgaactgttcaacatgtattttggagaggtaggttaaaaacgatatttttgaaagatttatttctatcaatgtgcatttattggcattttcattcctctcttgctagatcgacttgcaattgaaatttggcttgacgggcttccagatctagaaaatatcagttagaaatcaagttatcagaaacatagaaaattacctatccttgaacttaaaaattgtattatcaataagccatttctcgaagaaaacaaagcacattgctccatagtaaagaaaattgaaccaaaatgtcatccaccaaaagctgcgcatcattcctgttccaatagccatatcgacattctcgatcatcgaacggcttccataacgaagtccgacatatgcgaatctcagcatatacaccacccacgcaagagtacatccgaattccatatagtcttcgagctgttccgaaagtggtctcggcagagtaattttgttccaatctttcaatcctgccggaatcaactcaaacatatcctgacatatggtacattgaatgtttgatgttgtacggacccattgctccaagcatccattgtgaacgtaggcgactgttccgctacaagagcatggcttgatcagactgtcggaactctagaaatatattgctaaattagaaattgaaaagaaaaattaccgtatcgttatcgaaacatattctgcagattacggtttttgtagaaacttccttcggtgaccgaatagtttctaagtttctctcgattattgtgcacataatttcaaaacgagtagaaagtttgcaaccgacaatt