Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2092.7   

sjj_D2092.7RNAiJA:D2092.7
PCR_productsjj_D2092.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2092.7 Source_evidenceePCR966WS150 Sequence/Annotation Release
Overlaps_Gene D2092.7 Source_evidenceePCR966WS150 Sequence/Annotation Release
Chunk_score Abs_score840
Max_abs_score840D2092.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI66168346618493
Overlaps_transcriptD2092.7 Source_evidenceePCR966WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2092.71660atcttgcattttggattgccctcatcgtttttggtctcattgttattcagtttactgtgtatcaatgtcgtaatccaacatatgtagtcatatcgacaagcatcaattttattttctcaattatcctaatcacagctttgattcatacaggtaatcttctttcagtatttaaatgccaacataatttaaatccaaacaaaacaaatatgattctacaacagaaaacattaaaaaaagtcttctgaaataatggaactgttctaataagtttcaattaagttttaatttcagtgatcttgaaagacaataaagaagcatttttgaaagaaggtttgcacaaaaaaactctattttctggaacaatgtcagaaatgagaacatatcaagctagaatgaagtgctgtggagttgaaggagcggatgactacagtaaaagtcatataatgacatatgtaaacccggtgagtgacggattgaatgaagtccattatcacataccatttggagtatttactggagaagtactatgaaatacatttctcaacaaggcgcgtgcttcaaatagagtattttaaactattttacgaataataatgaaacagcttgttagcttttcaacatatgaaacatcgttctctgagttttagaaaagtttctagaccggttttccagtgctcctacaaccccaactctctaaccctttcaaatccaaaaactcctttttcaaaactacaaactccaactataacaggcggaaaaatatcagtattttataaaggattatcttatttgaagctcaccaacaaaacaattcgagttcctgtgactcgggaattctcaatctacgaatatcacttctacagtattccgatgtcgtgctgccgaaaatttgatggggttgtgtttattttttttaaaagttgcacaattgctttgttaccaaacaaagtgtgttgtgcagaatcaatgacattaatgacggaaaatggatgaattataagaaacttaaagtatttcttctataaaaattatattggcaatgaagaaaacggttagcgtactctgtgaaatttaggtgttctcaacgtaatctgacatctgaagaaacgcaagaagtgcggaaatatgcagaagttggaaaatgggatttgatgctcaagtactttgtcatgccagagtaagttgattgagtttttattttacaaaacagtatgaaaattacactttataaataaataaatattttctgaatttctccatgtactcccctgtacacataaaattttatttcagattaggtttgtattggtcaagaggatgtctgacggaatacgtggattcaattgaaacttatattactgtattgatttcaactcttgtcatttttgctttgttcactgcgttgactatcggatttgttattgttcttttattgtatgaggatggaatcgggcacattgtatcagatacaaaaatgttcggagttgaaagaaatacgggagttcattttttgatgagcttggatatgatgtaagaactttcagacgtttcattaacttaattatgatactttttattttcaggaacagtgatttccaggatgactttagtttgattgaattccttcgaaacactgatattgatcgctttgtagctggtg