Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_DY3.4   

sjj_DY3.4RNAiJA:DY3.4
PCR_productsjj_DY3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene DY3.4 Source_evidenceePCR776WS150 Sequence/Annotation Release
Chunk_score Abs_score706
Max_abs_score706DY3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI87686848769843
Overlaps_transcript (7)
WB_DNA_textsjj_DY3.41160ccaatacatttccaaaatccaaaaccaaatttcaaaagtttttcagaaacgaagacaaaaattaaactaccgccatatgtccacttttttggcttcttctgaaaacatttcaaatattcgcgataccgttgttttactggaaatcaacaaattatcgcagagtatcctgtcttctcgcaatatttttgagctgagaaaactaaaaccaacacgaaaaatggttgaaatcgagtgagctttctgtactttcaagcaaataaaatattcaaaaaattccagacattgttttgtgtctaaaaatgatacatttgttgcatgctccaaattaatttcaatgtttcatctggaaaaatatattggatcaactaattgtgcaaatatactggagtggattacaaaaatgttaaacaatggtggttatcataaaatgaagccatttgtctacaaagaaggtaaattcatacctgcccttttctaaatgacgaattacaattttttaaatttccagctcctttcactcgcgcatttcgtgcatctaaagttatgaaaaatgtggatccaaatgtgaagaggaatattcaaacttcaattgtgaataatttaaaatcaggagtacactggtgggctctgatggctttacgacaagttatgattccaattgtaattaaagaagaaagagttttgctgtggagagatggatatttaaatattttaacaaaagaaataaaggatttcaaacaacgttatatagttcaaaaagctccggttagttccatttttgcaagtttttattttgacagttattaccggaacagaaagttttgaaaatgcatatggcgcaacgtatttgacgcgcaaaatatctcgtagcgaaaagtacagtaattcttcaaatggctactgtagcgcttgtgccgatttacgggttcggtttttgaaatgaactaaaaacaattatgtatcgatagaatattaaaataatacagtagcacccaatattttttcagcattttataagaccgaatgttgccaccttcaagctctcaatttctcgtcaaaaattgcgacctttgttcaaaagaaaagcaatcgataaaaaaacagagacaatgcaatggaaaaggttgaattcgatgctctcatggtgtttggaaagaagt