Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E01A2.d   

sjj_E01A2.dRNAiJA:E01A2.d
PCR_productsjj_E01A2.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE01A2.4 Source_evidenceePCR171WS150 Sequence/Annotation Release
Overlaps_Gene E01A2.4 Source_evidenceePCR271WS150 Sequence/Annotation Release
Chunk_score Abs_score213
Max_abs_score213E01A2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI41317754132419
Overlaps_transcriptE01A2.4 Source_evidenceePCR271WS150 Sequence/Annotation Release
WB_DNA_textsjj_E01A2.d645tgaacggcttctacttcgactacttctggaggaatctctgaaattataaattataattatttttattttaaaaaaacgtaaatttcgcttcagaaaatccaaagtagtctcaaatttagaaatattacaaaagaaaatcgaaaaaatccaagtttaaaaagcgcgattttcctattctggtttgagaaaatgttgtattttttaagcaaaaattgattgaaaactcacctttttgacttccacattggtttgtctttgtccccgctgccactattcgttcttcttctgttctaaaagtaattttaaatgaaaataacattttttgaacgtgcaaaacggcaaagtacctctctcgacgatgatcttgaacttcgtgaatcatctgaactgccttcataatccaaagaaatatcactcatcttgtgaattgaagtagaaatcggcgcgcaatcaaaaaattccggaattcaataaaaaaatgatttcgaaaatgactggagataaaaaagaacagaatttctgcgcggcggtgttgccgagcaagtctccgcccactttaaccgtgcggcgtgcagcgttcaaattggaaaaaaacattgcgcgttctttagcatatttttcagtgattttctgcattttctgctc