Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E01A2.f   

sjj_E01A2.f RNAi JA:E01A2.f
Simmer:E01A2.f:Screen_A
Simmer:E01A2.f:Screen_B
PCR_productsjj_E01A2.f
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE01A2.4 Source_evidenceePCR721WS150 Sequence/Annotation Release
Overlaps_Gene E01A2.4 Source_evidenceePCR721WS150 Sequence/Annotation Release
Chunk_score Abs_score679
Max_abs_score679E01A2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI41296934131213
Overlaps_transcriptE01A2.4 Source_evidenceePCR721WS150 Sequence/Annotation Release
WB_DNA_textsjj_E01A2.f1521tcttctttttggcttcaactgagacactattcaatatacgcttctcttcggcggtgaacacctggaaataaagatttcttttaatttttattgggtgagaaaagagtttgtaacatttttggaatcgtgtttttttttaaattgttttgattcaaaaaattaatattttctaaaaaaatgtttttcaagatttcctttttttgatgcctgaacacttttaatattatcaaaaaatctgcaggtattcacgaacttagtgaaaaaatgcactgaacaaaatttagatcgacaaatcgaaaaatcaaaaatataatttctaccgatttttcataagtttttcagtgtttcaattgtttggagaaaaatttaaaaagtacaaaaaatcaccgaatctatctgaatacgcctttatgttggagttacggaaattttaatttttttttaaatcagaatttcgatgtttcgaaaatgaaattcccgtacattttggtgaatttccaactaattttcataactttttaagattttcgatcagaaaatatttcagcgaaactgttgttgatcggtttttcgatttttttttcaaaaaatttaaaaacgaaaacttttcgatttttgaagaaactaaaaatggaacattctccacattttttctcaacaatttaaactaaataaaatgaaaaatcaaattttatggttaaaaatcgaaaaatcgaaaatcggcacccttgcttgggccatattttgctttaaattgtcttttttctggttacgttctgattttttttaatttactaccaaatttaacagcagtttacaatttttcccaatttgtaaaaaaattgttcaataaaccctcacctggttttcttttctcaatctcgtcgcctccattgccttgtgtcgagatccggacatcacataaccaactttttcgtattcagcaatctctccagacgataaaccgatttctcctcgtcgtggaatacgttctccgcgagccgcgtacgcagccattccggcgccctctccttttagtagatctttaccatagtttccgggcttctcaacatcataaccaccaccttgatcacgttgtttaatatgttctgggagaattggcgtcggtgacatacttccttctttccatgttccaatcgtgccaacaatcttttcagactgcttttcttcccattcttcttcagtatcagaacgattattaatctttctcttcagctcagcacgttctttctttcgttgctcacgacgagctcttctctcttctttctccttatttgcctttttgctctttttcttctctttcttttccttctttttatcctttttacttttctttgatttcttcaccttcttcttcttcttctgttcaaaatcactttcctccgattcagaagatgtcgaagaatcgtcttcagaaacatttctaactgctctcatttctcttttcttctccttccttctatcttctttcagttcttctcgtttcttttcattttctgc