Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E03H4.11   

sjj_E03H4.11RNAiJA:E03H4.11
PCR_productsjj_E03H4.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE03H4.11 Source_evidenceePCR728WS150 Sequence/Annotation Release
Overlaps_Gene E03H4.11 Source_evidenceePCR728WS150 Sequence/Annotation Release
Chunk_score Abs_score602
Max_abs_score602E03H4.11
Specificity_index0.891
Rel_score1
Map_statusUnique_ePCRI1243357412434767
C54C8.3 Chunk_score Abs_score74
Specificity_index0.109
Rel_score0.123
Overlaps_transcriptE03H4.11 Source_evidenceePCR728WS150 Sequence/Annotation Release
WB_DNA_textsjj_E03H4.111194atcgaagaggcaagtcaggagaaggatattctaatgatagtcgcctcgaggacagatagctatgctcggaggaacatcatgcggcagacctggatgaataagtcggacagtgagattgtagcaaatgggaggatgaagccgttgttcttggttggattaacgcccggtgactataaaatgaagaagatggtgatgcaagaagcgaagctctacggggacattatcgtcgttgacatgaatgatacatatgaagagctgacctataaggtgagttattcgagcacaacgtgccaagagttcggatcagataatactcatagctacgtattaattatatcttctggttaatgcaaacatgctctactgataaaatgagtgtaaaactaatagtgccagttttcccagaaaattcaatttttgctagttctcgcacattcccttatactctcaacttcataggtctttcgagaatgtgaaaaaatgaacgaagcgaatgccaagtcacacagtattttactgccaacttagcttttttagtttgaatatctaagtctacagtaccactgtaacttcaatcctatttcatcttccagtcactggcgattcttctctacggagtcagcaaagctccacgataccaaatgatcgggaaaatcgatgaagacgtcatattcttcccggataagcttactgcactctacgagcaaggtatcatagatgctactccactttgcgcctatgggtacaaaatccaagctggagctcgtatattccgtgacaagaacgatcgatggttagtccacatattttattaagattgctcattttcaaagttaaggtatgttccggagtcttcctactcttgctccaaatttcccgagtatgtctcgggaatgttgtacatggtcacttgggaggctgcgcagcagatcatcaagtctacgaagtatcgagattttattcaggtgtgtgaagggttgatttataacttgaaccttcagagttacaggtggaagacgtgtttcttactggaattcttgcggaagacctgggaatttctgtgaggaacttgccaaaattctacaagtacccgaacgatgtaagttttgatttttgggattgtgaaacactaaatgataaaacatttcagattgatgaatccaaatcggtggatataattgcatggcacaacga