Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E03H4.6   

sjj_E03H4.6RNAiJA:E03H4.6
PCR_productsjj_E03H4.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE03H4.6 Source_evidenceePCR762WS150 Sequence/Annotation Release
Overlaps_Gene E03H4.6 Source_evidenceePCR762WS150 Sequence/Annotation Release
Chunk_score Abs_score636
Max_abs_score636E03H4.6
Specificity_index0.756
Rel_score1
Map_statusUnique_ePCRI1241730512418403
T15D6.6 Chunk_score Abs_score205
Specificity_index0.244
Rel_score0.322
Overlaps_transcriptE03H4.6 Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textsjj_E03H4.61099aacgtattgcaaaaccctcgaatccattcgacatttgagttcagcgccttcacgaaaatctctcgataatgaccatcatatgtgagttccgttttggcttttattttccgaatcaacttaaaattatattttttttccagtaactgatccagtgtgtccagtttgtgaattcccttctaatgtggaactccacttcggtggcctagtctgcggagcatgtgctgctttcttccggagaacagtttcactgaacatccgttacttatgtgaaaagaaaaatcaatgcaagggaaagagaaagaattgcagagcttgtagatttgattattgtgtgaaaattgctggaatgaaaagaaactgttagttttatagttgtttgcttgaacttaacaacaaaaaaagttttttagtagtaagacagagaaaaaattcaacaaacaccccaatgtacatattgaacagaagaaaagattccggaaatgaagaagtcgtcagaggtatgttaaaacgtatgtatgtatgtatttttaactcaatagttttccaggttttgtgacatcaacccaatctaaatgggcacaacattcgagaaagtcatctatgagtcctaacaaagaagctgaaaaagatgttagcaagatattgaaaataagtcatgggaggcttttaaagtattacatatatcaaatcacacaaggtaaatgggttaatatggtaataataaattatctgaaaaatctatttatttatacaattacagaatacattgaatataaaatcagtagaggaatttttggaaatcactagtattcacaataaactagcagctgaaatatgtaaaacttgtcctggagtcgatctacttgataatgaggatattttgactatacggaaatattttcaattttccaatgtttggattgaatctgcatggaattatttgatgtcagcagataaacatgttcaaattgatgactcggaacttgacttgtaagtgataacaatattagtgtatgtagttattatatgatattttccagaacactgcttaaattcattaaccaagtaaaatcaacgctgcttgtctcactttcccagc