Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E04D5.1   

sjj_E04D5.1 RNAi JA:E04D5.1
PF:GL1_3D10
PCR_productsjj_E04D5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE04D5.1b Source_evidenceePCR420WS150 Sequence/Annotation Release
Overlaps_Gene E04D5.1 Source_evidenceePCR942WS150 Sequence/Annotation Release
Chunk_score Abs_score837
Max_abs_score837E04D5.1
Specificity_index0.903
Rel_score1
Map_statusUnique_ePCRII1041697110418144
Y73F8A.37 Chunk_score Abs_score90
Specificity_index0.097
Rel_score0.108
Overlaps_transcript E04D5.1b Source_evidenceePCR423WS150 Sequence/Annotation Release
E04D5.1a.2 Source_evidenceePCR942WS150 Sequence/Annotation Release
E04D5.1a.1 Source_evidenceePCR942WS150 Sequence/Annotation Release
WB_DNA_textsjj_E04D5.11174gcttgcaatgtgttcgcttacagcaacaacggacagctgttcgcctattgcgataatcaagtgtaagaagaagtttcaggagaggaatatatagttaaataatgttttttttttagaacacgggtattcgagatcgcaacaaacaaggagattctttgtgtggagctgaaaagaactcggaagatcttgttctcaccaaaagacaatttcctgctcacattcgagccatgggcagtttacggaccaaaggtttgaataattttttatttaattcagtttgaaaacctttttttcaactttagactgcagagaaccaaaagccagaaccaaatgtgcgagtctacagtcttgcggatggaaagcacgtatcaacgttctcagctccaaaagaagcatcgtgggagcctcagttttcggatgatgagtcgttggctgcaagaatggttggcagtgaagtcttcttttatacaaacatgtctttcggtatgaatttcatgaattttctgaaaattgatattattattacgaccgttatcataaaacttatcttttcagaccgttacgaccacaagcttgtcgagaagggtgcgaccaacttcgcattgagtccaggtcctgctccgaatcacgtggctgtctatgtccctgccgttggatccactccagctcgcgtgcgagttcatcgagtctccgaatcgttcccagtcgtcggcaatcgtacgttcttcaaatctgacaaagccgtaatgacatggaatcagcgtggtcaatcacttctcattcttgcttctgttgaagtggataagacaaatcaatcttattatggagagcaaagtgttcgttttaaaattttctcaaatctccccaataattatttaattaatttcagctataccttatcaacattcaatcaggagagtctgtagttgttcctttggagaagaaaggtccaatttacgctgcaaagtggaatcccaacggccgagaattcgctgtttgctatggttatatgccagccaaagtgacattctataatccgagaggagttccaattttcgacacgattgaaggtccacgaaacgatgttttctataatgcatttggaaatattgttctgatttgtggatttggaaatatcgcgaagggaaaaatggagttttgggatgtggagacg