Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_EEED8.5   

sjj_EEED8.5 RNAi JA:EEED8.5
Simmer:EEED8.5
PF:GL1_7H2
PCR_productsjj_EEED8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSEEED8.5 Source_evidenceePCR1149WS150 Sequence/Annotation Release
Overlaps_Gene EEED8.5 Source_evidenceePCR1149WS150 Sequence/Annotation Release
Chunk_score Abs_score1128
Max_abs_score1128EEED8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII54022395403387
Overlaps_transcriptEEED8.5 Source_evidenceePCR1149WS150 Sequence/Annotation Release
WB_DNA_textsjj_EEED8.51149gagcttgtcgaagacgaacctgactttttacgtggatatggaaaaggcggtgcagaaatagaacctgtaaaagttgtcaaaaatccggatggttcattagctcaagcagctttaatgcaaggtgctctttcaaaagaacgaaaagaaacgaaaattcaagcacaacgagagcgtgatatggatacacagaaaggattcagttcaaatgctcgaattcttgatcctatgtctggaaatcagtcgactgcgtggagtgctgatgagtcaaaggatcggaataataaaatgaaagaaatgccagaatggttgaaacatgtgacagctggtggaaaagcgacttatggaagaagaaccaatttgagtatggttgagcagagagaaagtcttccgatctttgcgttgaaaaagaatctgatggaagcaatgattgataatcaaattcttgtcgttgttggagaaactggatcaggaaagactactcagatgacacaatatgcaattgaagctggacttggaagacgtggtaaaattggatgtacccagcctcgtcgtgttgcagcaatgtccgtagcaaagcgtgtggcagaagagtacggttgtaagctgggaactgatgttggatatacaattcgtttcgaagattgtacaagtcaagatactattatcaagtacatgacggatggtatgcttctgagagaatgtcttattgatcctgatctttctggatattcgttgattatgcttgatgaggctcacgaacgtacaattcatacggatgtcttgtttggattattgaaagctgctgctagaaaacgtccggaactgaagctgattatcactagtgccaccttggattcagttaaattttcagagtatttcctggaagctccgatctttacaattcctggaagaacattccccgttgagatcctgtacacaagagaaccagaatcagattaccttgaagctgcacatattactgtaatgcaaattcatttgactgagccacctggtgatgttcttgtgtttttgactggacaagaagaaattgatacatcgtgtgaagttttatatgaacgaatgaaatcaatgggacctgatgtgccggagctgattattcttcctgtctacggagctcttccaagtgaa