Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F01F1.7   

sjj_F01F1.7 RNAi JA:F01F1.7
Simmer:F01F1.7
PF:GL1_4A6
PCR_productsjj_F01F1.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF01F1.7 Source_evidenceePCR911WS150 Sequence/Annotation Release
Overlaps_Gene F01F1.7 Source_evidenceePCR911WS150 Sequence/Annotation Release
Chunk_score Abs_score869
Max_abs_score869F01F1.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII58522305853395
Overlaps_transcriptF01F1.7 Source_evidenceePCR911WS150 Sequence/Annotation Release
WB_DNA_textsjj_F01F1.71166tcccaattacgaagaggtcgtggaactctgcctcctttaatagaaatattgaaatcttcacggaagatacgccaatctctgtcagacatctcagaaagttctttcattctccaatgacgatcatcatgagccactttcttttcttttttcagttctttttcaaggcgatgcatctcttgctctttctcatcaacagttcttcgattttccatcatttcctggtagaacgagttcttctcttttttctgagcattcacatccgttccagcaacagatcctcttccaaagaactgaatttcatgtcgactttgatataatttgttataatcctgtgatgtatcctctccagcatcccaatcaaaaacaaactttttctcatgaagtctccgtcctcttttcttcttttccttctgttttccaagatatctgtctttaacagcatctgccattttactaacatcttcttcattatcactatcctcgtttctatctcttttccgatcatcatttcgatcccttctatctctacttctacttctatctcgacgccttccaccatcacgatcacggctcctgctccttcgtcgtctatctcgagaaccacttctctcccgacgatcccgtcgacgatcacgatcacgttcccgttcacggtctctgtcacgatcattgcctcggtcaagtccacgatctcttctatcgtctgatgttttttcggtgcgtccccaattttttcgagcttcttcagcttgtttttgtgtttcacgcagttttgcgacctcctcttctcttcgtttcagagccaatgcggcccgctcggcttttgacagaaattttggctgaaaatttgaaaatggtttggtttttaaaaaatatgcgatgttttttgagatattaaaaaataatacatacctttgccaattcatcttcttctcttttcttcttttccagaagttcctcaagtgatggaggttcagcagccatttctctggaatttaagaacttaaatgtttggaaaactaattaaaaatatgcttttacaatgggaaaatgtaaaaaaaccaatttttaacataaacctacagaaatgcattcacccttttcgtatataatacacgcgaccgaggtggtatttgttaggccgcgctctcttagcgggacattcg