Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F01F1.8   

sjj_F01F1.8 RNAi JA:F01F1.8
Simmer:F01F1.8
PCR_productsjj_F01F1.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F01F1.8 Source_evidenceePCR1132WS150 Sequence/Annotation Release
Chunk_score Abs_score1090
Max_abs_score1090F01F1.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII58536685854845
Overlaps_transcript (5)
WB_DNA_textsjj_F01F1.81178aaagttgggcttgttgaacgggatggggaatattatcaaacacggcaacagatcatagaaacggacacactggggggaatagaaaaacaattttaatatttattctggttgtggctgcttcaagttggtcataccagcgcgcatcacttcatcaacaagcaagagattgcatgcaagtactgtcgccgacgagatactgttcttcttcaccgtcacattgtcccaaattccttgtggctcgacagctcctccggtttcgagatcgagtccaacggcgatatctggtccagcggcggttttctcctcaataagcttaacaagtgtttcctgagcatcatatcctccatttacggccagtgtctttggaataacgagaagagcttgagcaaacgcttcagctccgagcttggcacgtcccttcaggttctcaacatcttttttcaacatcacgtaggcagcaatttcgaaagcagcagctccagggagaacagcctctgaaaataggttactagaacagaagttaataaaatttaaactcactgtcaacgatggtgttgaaaacagcacgaagtccatcatgaatagcatccttgatttgagtgatggtatgcttgtttggtcccttgataagaagagtcacagattttggagcacggcattcctcgataaacgtgtatttctcttctccaagggaatgctcgtaaacgagtccagcccatccaagatcctctggagtcaaatcatcaactgagttgacggcttctcctccgacggccagctgaagacgttccatgttacgtctcttggcacgacgaagagcaagaattccttcggaagcaagcaagtcaagagatggaggatcgattcctttctggttgataacaacgaatcccttattcttaccatctggagaattatcaataaccttcttcttcaactcaataatcttgtgaacacgacgagtaatgaattcacgttcggcagcgagaagtgcctcacgttccttggcggtcttgtagaaaagtcccgagttgacttcagtcttctcgtattccaaagaaacgttgcaagtgagaatgtaagcgtctttaacgtgtcttggcatatctgggtgacgagctccatgatcgagaactaatccacgaacaagtgtggtatccatatcactgtcgtggtgc