Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F02E9.1   

sjj_F02E9.1RNAiJA:F02E9.1
PCR_productsjj_F02E9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF02E9.1 Source_evidenceePCR465WS150 Sequence/Annotation Release
Overlaps_Gene F02E9.1 Source_evidenceePCR465WS150 Sequence/Annotation Release
Chunk_score Abs_score360
Max_abs_score360F02E9.1
Specificity_index0.841
Rel_score1
Map_statusBest_ePCRI84067828407714
F02E9.2 Source_evidenceePCR89WS150 Sequence/Annotation Release
Chunk_score Abs_score68
Specificity_index0.159
Rel_score0.189
Map_statusBottom50_percentile_ePCRI84067828407714
Overlaps_transcript F02E9.2a Source_evidenceePCR89WS150 Sequence/Annotation Release
F02E9.1 Source_evidenceePCR465WS150 Sequence/Annotation Release
WB_DNA_textsjj_F02E9.1933ttcaaccaatttttgatcgttctctgcttttttcaatcattttctctttttccttactgctttacaataaaagcgtatatttccagtgatgcctgcgcaatcaataaatcagaaaaatgatttatacctcgaaaaaatggaattaatcgacaaattcatcacccttcacgatcaacttcgaaaagacttgaacttggcaagtttgtgtatttctaaagcaaagtaagttttattcgtttcgtaaaatgaatctttatcgagaaattgttcagaacaacgcacggaattggtcttttcagtgttaattctgtcgatacacacgatttggagccatctatcaggtataaactacttttttttgaattatacttacttaagtgtattcatttttagattggatacgaaaaacgggaaatttgtacttctcaaaaattcagagaatgaggaagagaaaaacgacaaaaagaataagaaaaaggttttttgcaatcgttttttgttccacaaaaatttacatttaaattttttgcagaaggacgagaataaatcagaaaagaagaatagcggagaatcagaagacgttgaagaagccaaaaaaacattttctggacaattccgtccgtttggggttcttgagccggctgctgcaaaggacgctcgaaaaatttatagaaattctattcaggtattgaaaatctcaggaatttaatttcaaatccatttttcagacgattctcgaccttgtatccacccaacaatcaattcttgccaaatcccgccaacttgttgaggattgttaaattgcatgattctgtgataaatatgtattcaatcaatataaaaacaaaactctcgatttatttcagcgttcgcccgcaatagcggaacttacgagtagagattttcagagaaaatgatggatttcagcaagaa