Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F02E9.3   

sjj_F02E9.3RNAiJA:F02E9.3
PCR_productsjj_F02E9.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF02E9.3 Source_evidenceePCR903WS150 Sequence/Annotation Release
Overlaps_Gene F02E9.3 Source_evidenceePCR903WS150 Sequence/Annotation Release
Chunk_score Abs_score819
Max_abs_score819F02E9.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI84044688405890
Overlaps_transcriptF02E9.3 Source_evidenceePCR903WS150 Sequence/Annotation Release
WB_DNA_textsjj_F02E9.31423ttgcaacaatcacaatcgtaaacattgatactgaaattaaacttattacaaatttttatatttttacaaacttacatttttgaatagatggtcttcaaactagccggctttgacttcttttccttcttactcttcatactttttctacttttcttcgagcttttcaaagatcttgcaatttcatcaagttgctttttcatagcacattgcttcaacatcaaccgacttctctcacgagttcctggagatgaagctccagggaaacgagttccagaactgacacgtgtcaatttgataactggagaagaatcttcagatccagtcgggcttctactttgatatgtttttcttgatcttgaagaagaattattagcatcttctctctcctgaatacttgattattggagttaaagaaaaaccgtttgaattactttttccattctagcaaacgcacgagcagcttttcttgtcgtttctctagttttctccgatcgagcaccagggaatacggtcggagcagtcaatgggctgaaaattaaaatgttctattgttatgaaatcggatcttacattccccgataatcataagcaacggccgtcagaacaggtgaacttgtggttgtcgatgatttttgcgatttggaagattgtgaagacgatctaaaattttcagattacaatgatttttgttttcacaagagtacggagattttccgatatttctttttatgctttatcatttgtggtagaaatctgattgaacacgtagagggcgacgtgtagaagaatagagatataagcaggcaagtaggcatacagtcatgaaagcagctaggcatggatctgaagaatgcctggagacgtgtcatgtcagccttccaacgtcttccttcctactacgtatctacatatctagctgcgtacctaccaattcctgcctgtctatctacgtgcctacatcgcatcagccttcccacttgcctatatcatgcctgcccattcttaaaagatcaaaaactcacaaaatgtcggtctttgccaaactgtgcggacacgtggttccaatttggaatcgttttctaattttacagtttaaaatcttcaaatcctccaaaatctgcattgtttcatcatccaaatagtcagttttgtcttcacgtctgttgaattgactccatttctttgatacgtggattgcacgtgacgtcattcgttttccatgtttcgatgatgacttcggtttgccttcttttgatttgcgatcttttttgagagttttgagattcagagatgagtttcttgatggaggagacgaagatgatttagatgaacgaagtgaatcattaatattctttccttcaggttttactgaaactctcaacatttcctcttccatatcatcattggctcgcttgtaatagat