Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F02E9.4   

sjj_F02E9.4RNAiJA:F02E9.4
PCR_productsjj_F02E9.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF02E9.4 Source_evidenceePCR791WS150 Sequence/Annotation Release
Overlaps_Gene F02E9.4 Source_evidenceePCR791WS150 Sequence/Annotation Release
Chunk_score Abs_score686
Max_abs_score686F02E9.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI84211028422290
Overlaps_transcriptF02E9.4 Source_evidenceePCR791WS150 Sequence/Annotation Release
WB_DNA_textsjj_F02E9.41189ttgggtgcagaaaaagaaccaaaaaatcgaccagagaatgatatggatgcagttatgagaaaagatttacctgccattcaaccaaaacgaggtcttcgtgatcaaaaaatgttgcaacaagtgaagaatgttgaagcagcaacagtgtgtacactaggtcctagttatcgatttatgaaggatacgaaagcaactgattgtagtggacgtgttgagctggatgatgatctcaaaggagtatggaaaattacacaaatttaaaaattttatttgaatgatattttcaggttctcaatgatacgtggacatcaataccatcatggtcatctgaagatactggtagtcaggcgattaagaaatcgaatttggaagaatttcatttcaaaaccgaggatgaacgttatgaggtttgttttttttcgatgtgaagacaatttaacaaatattcaattaacaagattatttaaaatttcagcttgatattattgttgattcaaatcgaactgtcatcgaacaattgtcaaaaacacttcgagattacgaggcgatgagtgatgaagataagaagtcgttcaagtaagtattcagatattatatctacaaaaataccacataaaattgaaaaaaaaaattatcgaggacctcttagaaagggattctgctacaccgaaattctctgtccgaacttccgaaaattatttagaaaatatcaattgttttttgaaaacgaaaccgaaaatttgttttcattgtaaaaagtgattttcagattggacaaatggctcaatgcttcatctcgatccaccacaattcgtgttctagcaaaagtcttcacaaactctgctcaagatttcattgatgctgcacaaaagaatccacttgtaggtttacgacgaattcttgaaagtctgaaggagaaagacttgctgtggagtcgattccaacaggatactaacaggttttttacttaatttccctcaaaactttctaaaaatatcaattctagaacatggagagacgctttggacaagcaaatgtcggctgcaacgacgattttgaataatcaacacaagaattacgatcaaaaagcgttcaagtcgaagcctcttgttaatcaaatcgaacaaatctgtgaggaaagacggaaaaagtttgtttttttttctttaaaggtggagtggcgttaatg