Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F02E9.7   

sjj_F02E9.7RNAiJA:F02E9.7
PCR_productsjj_F02E9.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF02E9.7 Source_evidenceePCR728WS150 Sequence/Annotation Release
Overlaps_Gene F02E9.7 Source_evidenceePCR728WS150 Sequence/Annotation Release
Chunk_score Abs_score623
Max_abs_score623F02E9.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI84145628415714
Overlaps_transcriptF02E9.7 Source_evidenceePCR728WS150 Sequence/Annotation Release
WB_DNA_textsjj_F02E9.71153cgatccggaaagagattcaaaaagttttcgaattttgttagttggtgatacaggaggtataaaatgattttagaaaaaagtgtatctctagtaattcaggaattccaatattggagacgacttgggcacaaaatgaagtcaaacagacaatggcatcattagcagatgaacatagtgttcaaatgatattaaatatgggtgataacatatattttacgggacccactgatgaatttgatccaagattcgaggtttgtacttttttttaacccaaaattttagtaaatccctctaaatttaaaatatttcagtcacgtttcgaaaatgtctacacgaatccgagtctacaagttccatggctcacaatagccggaaatcatgatcattttggaaatgtgaccgccgagattgaatatacaaaacatagtaaaaagtggtattttccatcactttactataagaaatcagtagaattcaatggtacttctatcgattttttaatgattgatacaatttccttatgtggaaatacaaaggatattcaaaatgctggttttattgaaatgttacgtaatgaatcacatgatccacgtggtcctgttaatataactgccgctgaagaacaatgggcatggttggagaataacttagaagcaagcaggttaggaattttggattttttcaaaaaatgacctcgccacgacctttttgtaaaataaaaacaggtatgcacctttaaagtactgtaatttttaactcttgttgcggaattttcatctatttttaaattgttatattcaagattaaaaaaaaaggcgcacatttttgcattcaacaaaatttagtcgtgccgagaccgtgcatcttatgcctggcccagaaatcggaagatttcgcttctgggtaatggaaatttattttaaaaatcctctttcagtgcccaatacctaataatttctggtcattatcctgttcattctatgtcatcacatggtccaactgactgtttacgtcaacgtttggatccacttttaaaacgatttaatgtgaatgcttacttctcaggacacgaccattcgttgcaggtttaccttagtaattttaattcaaattactttataaatgtttcagcatttcacttttcccgggtatg