Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F07A5.1   

sjj_F07A5.1 RNAi (8)
PCR_productsjj_F07A5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F07A5.1a Source_evidenceePCR933WS150 Sequence/Annotation Release
F07A5.1b Source_evidenceePCR939WS150 Sequence/Annotation Release
Overlaps_Gene F07A5.1 Source_evidenceePCR939WS150 Sequence/Annotation Release
Chunk_score Abs_score818
Max_abs_score818F07A5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI73504937351683
Overlaps_transcript F07A5.1b Source_evidenceePCR939WS150 Sequence/Annotation Release
F07A5.1a Source_evidenceePCR933WS150 Sequence/Annotation Release
WB_DNA_textsjj_F07A5.11191aatccgtaattggtttctggaataaatatatgtataagggagacatttgaaaaactaacctgaataagccaaatctcttggacttgaagtgagagttggagcggtctgcaactagtgggatattagaataagtacaatatttatcaaaaaccaaccggttcaaggccagcgtctgagcaatatttcttgaaaagagcaccgatgacttcttcagttttcaaaaatccattcgtatccatcatgaaataaattaaaagaattccgtcggcacacaggtacttgtgaacaaagttgtagcggtgatcatgaatattactgtcgaatggctctcgttccaatgattttttgatcaatttgtagatcatcacctcgttgagcttcttacttttgatacgaagaatccacttaacagttccaattaccgagagcgcggtgagctgaaaatattcttgaaaatcgtggccaataggagaaaaaacgtaccacaagaagccaaaagtaaagcccaatgaaaattttctcgttaatcacattcatcggaataatgcattgagctttatgattcacaaagttgctaactgattcttgcaactgatattcacatcccacaagaattgggaagtactggaaacgattgtaactgccgtctgtgagaattgccgcgaatctttgtttgtcggaaaacgaggagaactcgggagcacgtggagttgggtgaatgaatttgccgagaagctgaaaatagaaaaaagacatacttttattatcagtgtcattcaatttatatcaaaaacttgctcaactcacatcaaaaccccaagtccacgaatcaacgtccaagaatttgcaaaccaagttcacttgaataatcacattagttatgaaaaataactttgtgagactgtacaagacactgggaaaagctgagttaaatgtgatccacgatagatatcccattttgtgggcacgacggaacttgaagtgatcatgcatataattcacaattcgatccactttttccttcgtcttttcaaacgttttctcgctgttgatttttccagagtaatccacaatgaaagccatgtcaatgtctgaaagattaaaaatttatattactctacagaagaataactcgtacaaataagcttttgcatgtatgcccagcaccagaaaggaagaagaaagcagcat