Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F07A5.5   

sjj_F07A5.5RNAiJA:F07A5.5
PCR_productsjj_F07A5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF07A5.5 Source_evidenceePCR380WS150 Sequence/Annotation Release
Overlaps_Gene F07A5.5 Source_evidenceePCR431WS150 Sequence/Annotation Release
Chunk_score Abs_score327
Max_abs_score327F07A5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI73606037361801
Overlaps_transcriptF07A5.5 Source_evidenceePCR431WS150 Sequence/Annotation Release
WB_DNA_textsjj_F07A5.51199acagagtgtggaaggaaatttgaaaagtcgctagattcgattagtgctcttttaatcatcatcatccgctgcaacatcatcatttgcttctgcaacatgaacagggggagccgttattggagcttttagtgtatggtttccctgaaaaataaattgcattgtaatgtttaaaaacactattcacagttgatttaagatgtgaaaattagtaacgtcgcacagtaaaataagatcaaaatgtaattattaaagataaaacatgcagtgaataaaattttgtgggaataaacgcacaccgcgaattcacttcgaaaattgaagccaataccgaaaaccaggcatacagtttgaaagtgtttgacttaagttattgcactcaccttatactcttttccaagatgctctgttgttcctttccattgatcaatttctgatttatcaacagctccaatacccagataggcgcatccgatggtgtcatctccggtgcaagttctgaaaataattaattaactttatgctgcggtctcaaattaaaatgttacctttgagcatcatgtaccgaaatcacaattgaagtttgtgccagatcattctttgatgttccacagaggaacatgacagcttcattgtaaacagcagaacatgtatctgtaaaaataagttgaaaatgtgttctcttcgacgcttacggactcgtctcgagtgggaatgtgtacggttaaagcattaagaaacttgtggtccatgtagttttaacaaaatttttcgattttactaaaatgccttttttttgaattttcagaaatgttaacaaagtttttagtgtatgatttttttgctcaaagagcatatttcaaagagcaactattgtttaatatgattttaaagtaatgtcggtctggataaaccttgtacattttcgctcggtatcctttataggaaataattgaactcactttttatcactcttgacgactttgtctgtgtcttggctccttgagtcaacgtgattttgacgcaaacgtctgcaaaaaacttgattagttattcgtgtcttcatgtacatacatttttaatgggaaatgatgtctcatttgagtatctaaacaactagttttgtgacgtaagccctcttaatatttttcctgtttttttccattcaaattccgtgtggttcagcagagtcagacgatctt