Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F07B10.3   

sjj_F07B10.3RNAiJA:F07B10.3
PCR_productsjj_F07B10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF07B10.3 Source_evidenceePCR987WS150 Sequence/Annotation Release
Overlaps_Gene F07B10.3 Source_evidenceePCR987WS150 Sequence/Annotation Release
Chunk_score Abs_score861
Max_abs_score861F07B10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1127134111272997
Overlaps_transcriptF07B10.3 Source_evidenceePCR987WS150 Sequence/Annotation Release
WB_DNA_textsjj_F07B10.31657tggttgaatgccatttttcatattgggtaaaaatattataagttttatccatgccaagtaatcgatactttaattcctcctataggaattattaaacacaacttccactgatttgagttcagtaacgtttcgtcaaaaacatttagtcttgggaatatatttgttttcagctatattttttgtttatacagctaattaatatgtggtataacgaaaaaagtaataaggctttttgtcagattctaggaggagctgacgttaagacttcatactaaataagtcacctacgaaaaaaatcatttcacgtatagaagaacaaaaattcaatttaaatacaaaatgactgatcaacactgggttattatcacagatattgctggtccaatcggattttcaatgtccattttttcaaactctattcttttgtttttgatattttcacattcatctccaataaaaggtccatacaaacgaatgctcatagtattttgcatatttaccgtattctactcatttgtcgaagtcatgcttcagccactaatccatatttacgacgacactttatttttgattcatcgaaagagaatagacttgccaaaatggttaacacgtttggttcctagtgaatgaatttattgacaacattattcgttaaaaataatttcagctacctattgttggtgttacgcaatgagtttttccttgtttgcattacaatttttatatagatatgtggcagtatgcaagtaagttctgtaaaagtcaaaactgattagattcagaaatttagatgttaacagaaagtatttcatttgggattccagttagaaaacaacatttttcagaccgcaatatgttgatctttttgtcggatgtcacttttatgcttgggtagttttgatcttatcactagccacgagctggggactcactgcagctttcatgttcccacaaaccgaccgaacaactgaaatttttttgcacataatttatagttcatatgacttggagccttattggacagattatgttgcttataaatacgtacgatttttttgaattaaaacattttccaattggtaaaatttttgcagtttgatactgatgagaataatgtgagatgggtcaatgttcttagttttttcggtgtccttcagcacgggattgtaattgtgagaattttaaaacaggttaatcaaattttactacgaaaattcagactctaagttttggcaccctttattattgtggcatcaacacgtatctcaaaataaaaaaacacactggaacatcaaacagaactcgatgtattcaactacaacttttcagagctctggttgcacaggtaatattttttaatgtttttctacttttctataaattaattgcagacaattttaccaatgttcatgatgtatattcccgttggtttcatgtttgcatgtccatattttgacttgcaattaggtgcatacaccaattatcaaacagtcatggcacaactttatccgggaatcgacccatttgtgatgctgtttttgatagattcttatagaataacaatatttggtctgtttcatagtgatatcttaaacaataattccaatttctaggatggttatgtccaagatttgtttatgtaaagccgatgcattcc