Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F07D3.2   

sjj_F07D3.2 RNAi JA:F07D3.2
Simmer:F07D3.2:Repeat_a
Simmer:F07D3.2:Repeat_b
Simmer:F07D3.2:Screen
PCR_productsjj_F07D3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF07D3.2 Source_evidenceePCR513WS150 Sequence/Annotation Release
Overlaps_Gene F07D3.2 (3)
Overlaps_transcriptF07D3.2 Source_evidenceePCR618WS150 Sequence/Annotation Release
WB_DNA_textsjj_F07D3.22435atgtttcggtgaaaagtcagaaatattgcaattctcaatattctctatggtaactccgtgtttttgttttgtctggcttttgactcaggttaggatccacctataaaactaacttttttaccagttaaacatgacgtcaatcttcctttctcatccccaaattcggattagcccccaccaaaaccagcaaaaagacggtgaagggcgggaaagagccgttggagaaaggaataccttcaacagcttgactccgcccacttcttcgtccgcttctcctcccctcaaaaaagcgagtcgggggtctcattcggaggctcttttctaagccaatatcatcttctttttgctcttttgtagtagtactaatagataataatattaatctttttattttcaaccaacttttcacctggtactccccctcatccaaattcagacatgttccacgccccacgttaccagatgatatttatgaaaagttgaaaatgtacttcatacaacctgaccttcgcagacgtatagctgaatctctatgtttttctgttcaacgttttttatttagttattactcatttttgttttatatgaaaaacaaggtataataggtataatatttgcttcctgctttaaggattcttatctcataaaatcctgaaatccattcctgccttcttatcttgttttcagtttttaatcattattttgaaaacaatatgattattccagaatatgaactctcgtgggttgattttgacgcttggcgtggtgatcgctgtagcattcgcacaacaggacagtgaagtggagagaggtaattttttcaacaaaaaaatatactaccgaggacacgatgcaccatgtcatttgtagtgttcatgaaactttcattttctacgtatctctcgggccacctgttcaaaaatatgttttgcagaaatgatgaagcgtaaatcagcgtatatgcgtttcggacgttctgacggtggaaacccaatggaaatggaaaaacggaagagtgcctacatgcgttttggaaagagaagtagcggaggtgatgagcaagagcttgttggaggagatgacattgatatggaaaagagaaagtccgcctacatgaggttggtttttcacctcaattgacctcccagtgtctgagaccaagtcattaaattattttattttgaagatttggaaagcgatctggacctcaagaagatgatatgccaatggaaaagagaaaaagtgcctacatgaggtatgtgaatgagtttcagatgagacacaaaatgaatgaattattattcaaaatgaatgaatatttattcaaaaaaaacatagaaatgtttcagatttggaaagcgatcatcagatatggaagttattggaaatgaaggagttgatggagatgcacatgatctttttaaaagaaaatccgcatacatgaggtgagagaagtgaaaagaaacgaaaaaagttattctagggtaaacatggctgaacccattcatttctaagttgacacaaaaacacgaggatatcttacgcacaactagaatgctcttgtaaggaccaactggaactttattcctttgaaatatctgaaaatactaatcgaggaacttttatttcttgattttgaaacgatcaactctttcttaacattttttggcaaatagttctttagagatatgtttctagtttaatgtcagttatcttttcttaaagctaatatcttcagtaccatattctttgagtaacgtgtttgttgttcttttgtgaaagtactgaaaaacgtgtgttcaaacgatttaatcatagcttcattcgcgaaaatcgccgaaatataattttgaacattgtgacgtcatacaatttttactgagagactatttcagaaaaaagacacttgacgtcagaccattctgaacaatttcccgtaatttttgtaagtaaaaagagacattcgtttttcacttattgaacaccatggcaatgggatttccgctgatttgtgatattttccctttgattgaaaaccaaatggcgcgcgcattttcgcgcaatggtcccgccacgcgcatcccattgatttgttgagcgcatggcgagaccaatgacgggaccattttgtataaatgcgcgcgcctttaaagtcgtagaagtggaaaaaaaatgcactgtaatttctgcatcactctattttacgaatagtgagctattcagagattaagaacttatttattttcagattcggaaaacgttccatgggtgaggaggaggaccacgatatgatgaagagaaaatcagcatacatgagattcggacgataaattttggacaaacttggatctatcatttatacaggctcacacatttaacttattttaaaatcaaataccttttaaaaactctcaactctcccgatgataaaactg