Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08B6.2   

sjj_F08B6.2 RNAi JA:F08B6.2
Simmer:F08B6.2:Repeat_b
Simmer:F08B6.2:Screen_A
Simmer:F08B6.2:Screen_B
PCR_productsjj_F08B6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F08B6.2 Source_evidenceePCR274WS150 Sequence/Annotation Release
Chunk_score Abs_score232
Max_abs_score232F08B6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67571136758081
Overlaps_transcript F08B6.2.3 Source_evidenceePCR267WS150 Sequence/Annotation Release
F08B6.2.2 Source_evidenceePCR267WS150 Sequence/Annotation Release
F08B6.2.1 Source_evidenceePCR274WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08B6.2969ttcaatttccatgtcttcttcgtcttctcaattttccttcgtagggcttgtgtgtgaggttgtctcgcgtaaatgtatgcgccagagcgagagtgtgtgtgccaatcgaaacagcagcagcagcactctgccctctacaatgtctccattttcactacactctttcaagtattgattttcaaatgcgaagcacaaagcgaggaggagcgcagagaaaagactggcagggtcccgctggtgctcacttcttctctcatttctgtctttgctctgctctgctactccttttatagtactcattttttccaattcgactgatattgtcaatgtatagtcagaaacttcggttttcaattgaataaaatccatgattcgactgtttttcagttaattcaacctaatttaaacctttgcttttaccaaaaacctctttttttcaagttaaataatgtcagtcgaacttatttataggccaattttgaatgttcttaacaagtttaatttataacgtacacttgcaactacccgtttctcataactttctgaatactattcgttctccatggtattcgcaataattcgtataatttggctttcaaatactctttttcaaacgattctcatttccgattcaataaagaaatgtttcagacaagatggataaatctgacatgcaacgaaccgtcgactcgcttcgcagccagctcaatattgagcgtactccgatcactgtttcggcagccgagtaagttaacgagatcagaatgcccaactttcaaaattttgtttctttcagacttcgtcgcttcaccgaaagccaagaagatccacttgtgaacccaatcgacaagaaggttaacccatgggctgagaagagcaagtgcagcatgctctaaatcatttattcatccaccatcgctttcaaacctcacttttgtcatccataatactaatccaaacgccgatttt