Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08D12.1   

sjj_F08D12.1 RNAi (6)
PCR_productsjj_F08D12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08D12.1 Source_evidenceePCR852WS150 Sequence/Annotation Release
Overlaps_Gene F08D12.1 Source_evidenceePCR987WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII27914112793337
Overlaps_transcriptF08D12.1 Source_evidenceePCR987WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08D12.11927tggaaaattcactaaaattcggatttttactacgaaattctctaaaatcgtgaaaaaatacaattttccggtaaatttaaggcaaaaaccacaacaatttttattttaaaaagtgaaatctttatgaaaaaactgaaatttcctcgtaaaaatgcagtaaaaacgcaaaaattctcaaaaaattgtcaaaaaggggcatttttacgcaaaaaaaacctgaaaaatgtactaaaaaccccaaattttcgacgattttaacataaaaacctcaaaaattaatttcaggttctcgccggctcggatttggagcaatcgttggctcgtctacacgttctgctaaacgccggtcgccttccagaagccgtcggtgcaattcgtgatctaccgatttccggcaaacttggagcatcttctctgctcacttcaacgttgatcgccgccgattctcgagatgaagctgtaaaggagctcgtcgcagcttcaacggcaaaaaatcagactccagaagcgctgaaatcgattttggaggatttggtggaagttgagcagcaacggggcaacgagacggctgctacgaagcatttggagaagctcgtcgagaaattcccggaggatttgcagctgcagtgtcgattggtcggagcctactcgaagactgatccgaagaaggccgaaagccttagtgctaaggtgctgctggcttttttcctggaagatttgagccattttgaaggattttagagcaaaaattgaatttttcagaaaaatttgaattttcccgtttttcccctggaatttgagccattttgaaggattttagagaaaaaactaaaaatttctgataaatctgggttttctaccagttttcccagaaattttgagccattttgacaattttttagggcaaaaattgaaaatttcagaaaaatctgaattttctaccggtttcccagaaattttgagccattttgacaattcttagagaaaaattgaatttttctgaaaaattaaaaactttccaccaaaaatttcaaatttttagtaatttttctatcaaaaagtccaacttttcactgaaaattcgaaattttttatccaaaaaattagaatttgcagcgaattttcccaaaaagaaaccagatttcatccatccaaaaatatattttttttttctgaaaaactaattttaccttaaaaatccagctttccagcaaaaattggttttatttccaaaaaattcaaatttttagcaatttttccattaaaaaacccaaattttcaccagaaaattcaaatttcccgcttaaattaactccaaaaaattaacaaaaaaatatattgccagctgttcccggagacgatggaagtcgatgtgaacgttgacgagctcgaggattcggattggatcctttacggtgagaaataccgtcaaaagaaggaggcaaagtcaccacaaactgctgaaattgctgctactcgaaagctgaaaatcgcgacgaagcgaaaacggaagattcgtctcccgaagaactacaattccgcagtgactccggatccagaacgatggcttccacgccaagaacgatcgacttacaagcgaaaacggaagaaccgagaacgcgaaattggccgtggaactcaaggatcttcgtctgcgaatccgaatgtcgaatatgtgacagcgtctccgaattcgccacgcccacttcctggtcccgtcgcagaaggaccccgtcaacagcgtcccaatttccagaaacagaagaagaagaagaatgcgtcgaaattttaaattttttttgaaaaaaatttccttttttttctattactagtaataattattgccccctgagatttcctttccctgaaaaaattgcgaaaaaagtgaaaaaaaaattggagaaattttggcgatttttgaaaattt