Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08E10.1   

sjj_F08E10.1RNAiJA:F08E10.1
PCR_productsjj_F08E10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY68A4A.9 Source_evidenceePCR894WS150 Sequence/Annotation Release
Overlaps_Gene Y68A4A.9 Source_evidenceePCR894WS150 Sequence/Annotation Release
Chunk_score Abs_score142
Specificity_index0.148
Rel_score0.173
Map_statusUnique_ePCRV1721311817214534
F08E10.1 Chunk_score Abs_score819
Max_abs_score819F08E10.1
Specificity_index0.852
Rel_score1
Overlaps_transcriptY68A4A.9 Source_evidenceePCR894WS150 Sequence/Annotation Release
WB_DNA_text sjj_F08E10.1_11417cacaaataatgctgaccttgtgatctgaaacaaaacaacagatttttatcgatttttaaaaaacaccctgtaacagggaaaagtcacaatttagtcaccaacattttctgaacttcaaatttcaaagtttctcctcatatagcccgcataaaggaatttccaaatcaatagttcagttcaaggaggtatgggtgccttagacattgagaccgccggaatcacgtatgcagtagacccacttccaaaaagccgccgaaacggcgaatagacaaagtctcgatatggcctatgaacaaaaaccatgatgagtgtggaggcaattccgtgaaccgcaaatgcaaagactatcaaattgttatgaaattgattctgatagtcaaagtatataaatgaattgacaggcaccacaaaaagaatcagtgtcactgatgtctaaatgtttgaaaatgtatgtttaatcccccaaaaaaaagattaacctgtataataaaagcgaccacaagcctgtgttgcatttgaactgtcttcttggaaatcccactttgtctggcgaagatcaagttgtaaatgttgagagctagaaatgttccacactggatagttgggaccgactctgccagaataatcgtgatggctggaccaagaagttcagtggcaaaaacgaacaactgacggccgtcatttgaaagttgaggaatacattggagcttctgtaagcggtctcaggtttaggccaaggattggcggaggaggagaaggttagaaaaataaatcccagaagatttgaaaattcagaaaaagaaaaagctcagatagacttcaaaccaagcgttcagccacaccaacttttgaatttaatctgtgccagttttgctagaactacttacatagtgacgtgtttctggttgtttttcgtggaattttatagattgaattttctacgaattaatttttctaaaacctaccctccacgagagttcccttcccttgtcctgttctggtataagaaagtgaattggcaaatcgtagagtggcacaataatataactgaaaactattgcaaatctccgtatatttctccaaaacgttttttgggcaaacaatatgaaaaagcgattctcaaaagtaacaaatactgatgtggttacgcctggaaatatatcccaatcaaaattcattacagctttgactcaccagtaataaaagtgacagcaaggtagaaaaacaggcccggggattcaattggacctaacccataccctgcgatagcaggtagcagaatatacggaatacctagaaaactgaaagtaatatcaagacaaatgcaccaacaatgtaggttgaacaacaaccatttgtcggatttcatgtgagccggcgttttgcagacgatacaataaaacccaaatgcatgaat
sjj_F08E10.1_21538cacaaataatgctgaccttgtgatctgaaacaaaactcaacagatttttatagttttctaaaaaaacaccctgtatcaggaaaaactcacaatttagtcaccaacattttctgagctacaaatttcgaaggctcttctcatatagtccacataaaggagtttccaaatcaatagttcagttcaaggagctatgggtgccttagacatcgaaaccgccggtatcacgtatacagtaggcccactttcaaaaagccgccgaaacggcgaatagacaaagtctcgatatggcctatgaacaaacaccatgataagtgtggatgcaattccgtgaaccgcaaatgcaaagacaatcaaattgttatgaaattgattttgatagttaaagtatataaatgaaatgaatgcattgacaggcaccacaaaaagaattagggtcactgatgtctaaacgtttgaaaatttcaaacctctgaaaaaggggtttacctgtatgataaaagcgaccacgagcctgtgttgcatttgaactgtcttcttggaaatcccacttcgccttgcgaatatcaagttgtaaatgttgagtgctagaaatgttccacactgaatagttgggacagactctgccagaataattgtgatcgctggaccaagaagttcagtggcgaaaacgaacaactcacggccgtcatttggaagttcaggaatacattggagcttctataagagcagcgagttttacttttagatactcaaaatcttcagagcgggtttttactcagtgtcaggcttaggttgaggcttcggctcaggcttaggctaaggcttaggctgaggctaatgcttaggcttacgcatacgcttatgcctaagcttaggcttagacctaggcttcggttcaggctttttaggcttgtaggcaaaaactcagagaaactccaagcgttcagtcaagccaacttttcaattcagtctgtgtcatttttctagaacttttcacatcagaagtgacgtgtgtttgtttgtttttagggaatttgttgattttctataaattaatttttctagaacctaccctccacgagagttcccttcctttgctctgttctggtatcaaaaattgaattggcaaatcgtagagtggcacaataatataactgaaaactattgcaaacttccgtatatgtctccaaaatgatttttgggcaaataatatgaagaatcgattctcaaaagtaacaaatactgatgtggttacacctgggaaatatatcgcaatttttttaaatgttaatgtttcaaatcagttttaactcaccagtaataaaagtgatagccaaatagaaaaacaggcccggagattcaattggaccaagtccataccctgcgatagcgggtagcagaatatacggaatacttaggaaactgaaagtaatatcaagacaaatgcaccaacagtgtagattgaacaacaaccatttgacggatttcatgtgagccggcgttttgcaaattatacaataaaacccaaatgcatgaat