Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F08E10.1_f   

sjj_F08E10.1_fSequenceCACAAATAATGCTGACCTTGTGA
PCR_product sjj_F08E10.1
sjj_F08E10.1_1
sjj_F08E10.1_2