Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08E10.3   

sjj_F08E10.3RNAiJA:F08E10.3
PCR_productsjj_F08E10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08E10.3 Source_evidenceePCR701WS150 Sequence/Annotation Release
Overlaps_Gene F08E10.3 (3)
Y68A4A.8 Chunk_score Abs_score130
Specificity_index0.165
Rel_score0.197
Overlaps_transcriptF08E10.3 Source_evidenceePCR701WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08E10.31181ttgaataggacttcaaaacgcatgcctacctgaccttgaggtgacgtccgcctgcctcgcgccttaactcacaccttctgcgaaaacacacgtaaactttacacgacaaaatgaaagaagaggcaagaggcaggcgtgaggcaggcagatagctttccggtaggcatcaagtcctgaaatcgcgcttgcctaccgtggaagccctatacttcaaaaaaccttttttggctgaattcaaattgggcgccagtagttatgaaaggcctgatttgggagcaatagcctgcgagccagacagtacatttttcgtataccaaataaacccagtaaatgcattccaggcgccgccttatcatacatcaatcttttcgaaagccgtgctagctcccttcttgccaaccggttccgaatatctagtaacaaatcaaaaattctctattattgcgcggtaatgctcccagctgtgtttctgacccctctgctcaagtttttccctgaagatcaagacgttgctaaactagaagcattgaagatttatccctgcccaactcaggaatttttcacgacttcagtgttcatcgccttgattgatcaagttgcaattcgatatgctatcattccattagcattggcagtgagcagcgtactgggtcattttctatttcatatggtttgcctggtgtattatatttatgtagtgccatctaaattcgtttccaaggagacacagggaaaacagaaaacttttctaatcagcattttgtttcaaacctccatcccctttgccgtagtgatcataccacttgctattgttttcgccttcaattcattcggctactattctcagaaagcaatgaacttggctttttgctgcgcactacttcatggtctgtgcgaaagtgttggcgtgattgttgtgcacaaaccatatcgagacgtgattggtttaaagatcggaagattgttgttcaaaagtaattttttagaagtgaagttttataacacatgataagatttcagggtcagaaatttccattcacgttcagccatcactcactcgagccagtggaaacctaactaatttttgaataattgcttacttctacattttgttcagtaataaacgagttctagcttgaaaagggatttgtcactccttcctgttcatgtattcggaaaac