Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08E10.7   

sjj_F08E10.7RNAiJA:F08E10.7
PCR_productsjj_F08E10.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08E10.7 Source_evidenceePCR639WS150 Sequence/Annotation Release
Overlaps_Gene F08E10.7 Source_evidenceePCR639WS150 Sequence/Annotation Release
Chunk_score Abs_score555
Max_abs_score555F08E10.7
Specificity_index0.775
Rel_score1
Map_statusUnique_ePCRV1748885017489863
T19C9.5 Chunk_score Abs_score161
Specificity_index0.225
Rel_score0.29
Overlaps_transcriptF08E10.7 Source_evidenceePCR639WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08E10.71014aactatgcatggaaacttggaaattatctccataagaatcaaaacacacggtttgcagactataatatttgaggtttccttttgttggtttgcacttcgctgtctatagcaaaagtataaaagagatctgatttgttttgaaaagtatcactgcttacgatgaagcttatcattctcctcctggctcttactgcagctgcccatgctgaacgtcacttcaatccacaacatcaatggaacgcagaagcaatcgataatattgttttcattcataacaagctaagaaacgctgcttcgcatggactttgggaacgctacagcatctccaaatcgtcaaacatgcaacttctggtaagtttttttcaattttaaattaatttcattatatatttttagtcctggaatgagtcattggttgctgaagtcgagaatgaaaaatactactgtgaacctgctgataacaaaaacctacctatcaaacttggagataacatctaccaatacgatgtcaatacttatgacgatattgatgtgagtttccataacaaaaaaaaacgtttaaattgtcgggattcagggcgttggagcaatgggaagtattaataaggatacacacaatgcgctgaaatccgaagagaaagctacaaagaatcgtcttagacaaatgctttactctaaatctaagtcaattggatgtatctacgaaagttgtgacaagattgattcaaaggggatcaactataacactcgtcttgttatctgcaagtatagtcctccgtgagttttcaacctgaaattgcgtttgtaaagttttaatttcagtttggagaatattgatgagcaactgttcgacaaaggagagccatgctctaactgcccaagtgggacatcgtgtggaactgatccaaatgaaatgatgaaactttgtaaatgagttctaaaaatgttaaataaattggtcgagcattaacctgatttctatacaaatgcatcaagtaaccaaaaatcaaggga