Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08F8.2   

sjj_F08F8.2 RNAi (6)
PCR_productsjj_F08F8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08F8.2 Source_evidenceePCR864WS150 Sequence/Annotation Release
Overlaps_Gene F08F8.2 Source_evidenceePCR864WS150 Sequence/Annotation Release
Chunk_score Abs_score801
Max_abs_score801F08F8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII73606377361713
Overlaps_transcriptF08F8.2 Source_evidenceePCR864WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08F8.21077tgaaaatcaagatcgggctcgtcaagagtttcagtcgtgcagtagatttgctaaactaaagtctatcgatattacaattgacggaaatctcgcttatcttcgtttcgatgctcacactggcgatgcaatgggaatgaatatgatctcaaagtgagtattaattagcgaaaatttcaatcacaaaacgcaggaaagaaggaaaaccatttttatattattatctctgatgaattataaacatttaaaacaaaaaaaacgtcagaaacaaaaggataaataaaaaaaacctttcaaaaattgattcatctattttcagaagctgtgactctacaatgagattcctaatggaaaatttccctgaaatgaccgttctagctttgagtggaaatctctgtgtggacaaaaaagctgccgcaaagaattggacggaaggacgtggaagatctgttgttgcagaatgtctaattccaagagaagtcgtcacaaaaacccttcgaacaactcccgaacaacttgcttatctgacaaccacgaaattacatataggatcttctcgtgccggagcagtcggaggatcgaatgcacacgctgcaaatattgtcgcggctattttcattgcaacaggacaagatgctgctcaagtagtctcttcatccatgtgctcgacaagaatggaagttactgctgataagaatttgtatgtgtcatgtactttgccatgtgttgaagtaggaactgtcggtggaggaactattcttgcaccacaaagagcatgccttgaaagtcttggatgtgctgggccaaataaggagcaacctggacaaaatgcggaacgtcttgccgaagttattgcggccactgtgttagctggagaattatctttgatggcggctctgacaacgaatgagttggtgtcaagtcatatgaaactgaataggtcagtcttgggaatttcaaacaaacattacagtatttaattttcagatcaaaacaacaattgtatgctgacgactctggaaaagcaactcattttgaaaaggaagttgaaaaagcgggcagccttctctccggaaaaag