Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08G2.1   

sjj_F08G2.1RNAiSimmer:F08G2.1
PCR_productsjj_F08G2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK131.9 Source_evidenceePCR369WS150 Sequence/Annotation Release
ZK131.5 Source_evidenceePCR369WS150 Sequence/Annotation Release
F08G2.1 Source_evidenceePCR369WS150 Sequence/Annotation Release
Overlaps_Gene (8)
Overlaps_transcript ZK131.9 Source_evidenceePCR369WS150 Sequence/Annotation Release
ZK131.5 Source_evidenceePCR462WS150 Sequence/Annotation Release
F08G2.1 Source_evidenceePCR369WS150 Sequence/Annotation Release
WB_DNA_text sjj_F08G2.1_1882ttgtttcaagtcaccaactctcaacatgccaccaaagccatctgccaagggagccaagaaggccgccaagaccgttacgaagccaaaggacggaaagaagagacgtcatgcccgtaaggaatcatactccgtctacatctaccgtgtcctcaagcaagttcatccagacactggagtttcctccaaagccatgtctatcatgaactcttttgtcaacgatgtcttcgagcgtattgctgctgaagcatcccgtcttgctcactacaacaagcgttccacaatctcatcccgcgaaattcagaccgctgtccgtctgatccttccaggagagcttgccaagcacgccgtgtctgagggaaccaaggccgttaccaagtacacttccagcaagtaagccattcggctgaaaatgttgaacaacaaccgaacccaacggccctctttagggccacacatgacaaaaatccgaatattcttcttgttgataaatattatttgcatcgggagtttctgttttaataattagattttacagacattatttatttcattatgcatacaaacgctacagcaaacagcaatttaaaaacaaacttatatttcagactattttttgtgatgcattcatttattaaaataccttccttcagcatgtaatagagatttaaaagcagtagggtaactttttacgtgttctgggatgccggttaccgggccaattggtccataagcactattgagcatgctttttaaaaaatatattttcattggaacgtttggtttcgtcacttacaattatattttaccgataatatttacatataaacctgaattataaagatttggatccaataaaacttaaaaagagtgcagtgaacagca
sjj_F08G2.1_2882ttgtttcaagtcaccaactctcaacatgccaccaaagccatctgccaagggagccaagaaggccgccaagaccgttacgaagccaaaggacggaaagaagagacgtcatgcccgtaaggaatcatactccgtctacatctaccgtgtcctcaagcaagttcatccagacactggagtttcctccaaagccatgtctatcatgaactcttttgtcaacgatgtcttcgagcgtattgctgctgaagcatcccgtcttgctcactacaacaagcgttccacaatctcatcccgcgaaattcagaccgctgtccgtctgatccttccaggagagcttgccaagcacgccgtgtctgagggaaccaaggccgttaccaagtacacttccagcaagtaagccattcggctgaaaatgttgaacaacaaccgaacccaacggccctctttagggccacacatgataaaaatccgaatattcttcttgttgataaatattatttgcatcgggagtttctgttttaataattagattttacagacattatttatttcattatgcatacaaacgctacagcaaacagcaatttaaaaacaaacttatatttcagactattttttgtgatgcattcatttattaaaataccttccttcagcatgtaatagagatttaaaagcagtagggtaactttttacgtgttctgggatgccggttaccgggccaattggtccataagcactattgagcatgctttttaaaaaatatattttcattggaacgtttggtttcgtcacttacaattatattttaccgataatatttacatataaacctgaattataaagatttggatccaataaaacttaaaaagagtgcagtgaacagca