Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F08G2.2_f   

sjj_F08G2.2_fSequenceAATAGTGTCTCTGCAGTTGCCTC
In_sequence F08G2
ZK131
PCR_product sjj_F08G2.2
smd_ZK131.6
smd_ZK131.10