Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08G2.3   

sjj_F08G2.3RNAiSimmer:F08G2.3
PCR_productsjj_F08G2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08G2.3 Source_evidenceePCR411WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcriptF08G2.3 Source_evidenceePCR411WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08G2.3836tttttgagacggattcattcctacttttgccattaaataaatgaactaaatttcaaaagtgtacactagaaatattcaatacacaatgacaaaaaacaacaatacaaatttattagaaatcaagccggattatattacatttgtggccctaaagagggccgttgggttcggttagattttgagatcaagctggctcagtaccattggaaggcatttaagcacgctctcctcggatacgtcttgccaattggatgtcctttggcataatggtaactcgcttagcatggatggcacacaagttggtatcctcgaaaagtccaacgaggtaagcctcggcggcctcttgaagagccataacagctgaagactggaatcgaagatcggtcttgaaatcctgggcgatctcccggacgagacgctggaatggagctctgcggatgagaagctcggtggatttctggtaacgtctgatctcacgtagagcgacggttcctggacgataacgatgtggcttcttgacacctccggaagctggagccgatttacgggcagccttggtggccaattgctttcttggagcctttcctccggtcgatttacgggcggtttgcttagtacgagccatgttggtttggttggaaatccgcgtggaatgttaaggaaagggtgacttactcatttcttatatacacagatcggatggtaagcggagtgatttcagccagttagacattcggtataatacctgaaacatgaaaggctccccactgggcgaaaaactcatagtagtgtccggcgaatcgggcgtcctttggcatggtggtattgatgtactt