Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08H9.8   

sjj_F08H9.8RNAiJA:F08H9.8
PCR_productsjj_F08H9.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08H9.8 Source_evidenceePCR958WS150 Sequence/Annotation Release
Overlaps_Gene F08H9.8 Source_evidenceePCR958WS150 Sequence/Annotation Release
Chunk_score Abs_score832
Max_abs_score832F08H9.8
Specificity_index0.82
Rel_score1
Map_statusUnique_ePCRV1448005714481454
F08H9.9 Chunk_score Abs_score183
Specificity_index0.18
Rel_score0.22
Overlaps_transcriptF08H9.8 Source_evidenceePCR958WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08H9.81398cctttctccgaaacaagcagttattgtcaatctcttggcggaactcaagtattcatctcactctcatacgagtttactttcatgaaaacttttactcaaggactatttgctcaaccatggctatccataaccagagatcccactgacaacaaatggtataatccagatggaaccacaccatttatttcatggtggagcacgggtgagccaagtcttaatggtgattgtgcaactttcaagtcaacggatccacaaggaatgaaagcaacaccatgctggagtatccaacctgccatgtgcaagcaaatgcctgcaatttgtccggatccaaagaagatttatggaggccaatacactagatctggaaatatcacatctccaggatatcccgtgcaatattacaataacttggactgcttgtacactattacttgtaagtggtgtagaacgaaaaattcttgacaataattaatttcagctccaaacaaaacgtatatcactctcacattcaatccatatctagtggaaggttatgtggattatgttctgatttatgatggcccagacactacttatccaagccttggaaggtaagaatcgatagttaagaagttttatcaggaccaggtggacggccagctaatttttggctgattgggctaagacactttgcttatttgtgggttaatttcgttagtattgccaatataatttacatgttagtaaaaactaccattcaaataaaaaaagcattaaaaaatcacgattttattttccaaaataattgtttcagcataatcagccgagcgttaaacctcggttaacggctaacggctaactctatgcaaatcttagccgaccacccctggcccacgaaactaacatataacgtttcagtactagctcagcattaaagttggaatatgaaagcacgaacaattcagtaactttgaagtttcatacagatagatcgatcactaacaaaggatggcttttgaaatggaatgcaaagtaaaaaccctcctaacaccctcacaacaattcgatattcagatcaaacacacctccagttatccaaagtggaaatggcggaaactttacatcacctaattatccaaatgactatgattcctatacagagcaaatgttctacttaacagttgctgatggattccaagtgaatgttacaattgatgatttcctaacagagaacagatttgatgttctagaagtttatgataattatacaattccaggagtcaatatgattgcaaagtttgttatgggaaagttcaattaaattttatagaattgttttcagcttaaccggtgattcaattgctccatggaattggctctctcaatccagccatgtcacaatgagattccgaaccgatg