Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F09C3.3   

sjj_F09C3.3RNAiJA:F09C3.3
PCR_productsjj_F09C3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF09C3.3 Source_evidenceePCR845WS150 Sequence/Annotation Release
Overlaps_Gene F09C3.3 Source_evidenceePCR845WS150 Sequence/Annotation Release
Chunk_score Abs_score824
Max_abs_score824F09C3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1428603014286874
Overlaps_transcriptF09C3.3 Source_evidenceePCR845WS150 Sequence/Annotation Release
WB_DNA_textsjj_F09C3.3845aatcctggctttctttccgtcgaaactttcaatggatgttctgttcttaaggggtaatgtctcaattccttctagtatttgtgatttgtatttttgattcttaatatcaactttagcctgaagatatttcatcctggggttcgaccctcgcatccagtgtttcaaaaatttattcaataattggctttcaacataacactcgagcactatacgctcacaattcgagtttattgcctgtagcaaataaggtctccaatcgagaaatactatacgatggagatctctggctaataaatcgtgtatctcatgtctgctgataaatctttcactgtattcgatagaaaaccgttccgtgttgtccgaaaaaagttgaagaactcgatcatagaacatgcattcattataatccatttttgaagccgatgcgctgaataatccaatcggaaatcctttgaatatctcattgattgattgtaaatccgacatatttttaaaactaagaacatggattttcggcagatggagtagaactagcaaatgctcaatgagtttgcgaagtgtaatcttgggcatttttctatatttttctgccactctccatcttccatgcccatagtactttccatccagcggtgacattgtttcagaacaatctcgatctcctccagttgtgatatcagtatatatccaaaaccctgcagatttattgtccatgaacttggcttcaaccatgatacagtggggtgtgtgctttttacaactgtgtgtgcattttacttctagacgagttgctttactatttacagttattgcaagattcatgcactgtttcgacgcaaatgaga