Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F09F3.9   

sjj_F09F3.9RNAiJA:F09F3.9
PCR_productsjj_F09F3.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F09F3.9 Source_evidenceePCR1054WS150 Sequence/Annotation Release
Chunk_score Abs_score970
Max_abs_score970F09F3.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1387706613878261
Overlaps_transcript F09F3.9.1 Source_evidenceePCR1054WS150 Sequence/Annotation Release
F09F3.9.2 Source_evidenceePCR1054WS150 Sequence/Annotation Release
WB_DNA_textsjj_F09F3.91196accgacaagacaaggcagatggattcctctcaaaaattggaagtttaactactgatcgccggactgaatggagcataaaccgggaaaagttcttcctaaataacaagaataacaaaaagttattggagatcattgagacagcacaattcgtagtagcgattgacggaactaatcattggggagttgaatcaactaaacaagtatctcggtatatgaaagatatgttggctggagatggtactaatcgatggtttgataaaactatgaactatgctgttgacgagacgggaagaggtggggctactggagaacactctccttgcgatggagctgagttagaccacctttgcgagaatttcttgaacattgacaaacaaatcttgaagtccccgagcaaagaagaacaattggagattgcgactgtcactgagcaagatttgaaatcattgaaattggcagaaaaacttgattttgaaatagttgatggaatggaatcagaaattgaaagatgctatgaagctcacacaaaatcgttcaacgatcttcatatgcattccatggtgtttttggattttggaaaaggaaaattaaaggaatgtggaatttctccagatggatttgtccaaatggcaattcagttggcttattacaaagcaggctttaattttaaagattattaacaaacttatcttcatttttaggatcaaggaaagttcactcaaacatatgaaccaggttcaattagattctacgcaaattcaagaacagaaactttgagaccagtaacaaaagcgtcttgtgaatttgttgaagccatgctctcggataaatctgatgtacgtatacaaaaatatgttcaattcgataaaattttgattttcagatagcctcccgcaggaagttattgaaagaagcttgtgaagttcatgtgaataactgtaaagaaatcatgctaggaaatggatttgatcgtcatctatttgtactatgtgttcttgcaaaaggacttggatacgaaagtccattcctcaatttcttccaaagtcagaagtggcttctgagtaccagtaatgtatgttttccgaattatttttcgcaaatatgtagatatttttccagattcccaatatgacaaactcgattgatgaagattcttcaattgacaagataatgcttggtggttcatttggagctgt