Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F09G2.4   

sjj_F09G2.4 RNAi (3)
PCR_productsjj_F09G2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF09G2.4 Source_evidenceePCR1066WS150 Sequence/Annotation Release
Overlaps_Gene F09G2.4 Source_evidenceePCR1066WS150 Sequence/Annotation Release
Chunk_score Abs_score1003
Max_abs_score1003F09G2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV71825437183721
Overlaps_transcriptF09G2.4 Source_evidenceePCR1066WS150 Sequence/Annotation Release
WB_DNA_textsjj_F09G2.41179accggagctcatcacatttcacttccgcaaatgcgacgaaaagatcgagacgagcagttggtgacgaaaattttacgaacagtacgtcaaaaaggagattgtatgattgtaatcgatacagctggaagagttctcgagctggcgcatcttttagatcaattatggtccaagtaagttattcttttaatttgaaataaaaattattaaaaataaaaatttcagcgctgatgcaggtctatccacgtataatctcgtcatgatgtcacatgtagcatcttcagttgttcaattcgcaaaatctcaattagaatggatgaatgagaagcttttcaaatatgattccagctcagcccgttacaatcctttcacactgaaacatgtcacactctgtcattcacatcaggaattgatgagggttagatctccgaaagttgtgttgtgcagtagtcaggatatggaatcaggattttctagagaattattcctcgattggtgttctgatccaagaaacggtgtgattttaacggcacgtccagcttcattcactcttgctgcaaagcttgtcaatatggctgaaagagcaaatgatggtgttctgaaacacgaagatcgattgattagtttagttgtgaagaagagagttgcactggaaggagaagaacttttggaatataaacgaagaaaagctgaaagagatgcagaagaaactagacttcgaatggaaagagctagacgacaggcacaggcaaatgagagtgatgacagtgatgatgatgatattgctgctccaattgttccaaggcattcggaaaaagatttccgttcgtttgatggctcggaaaatgatgcgcatacttttgatattatggcgaaatgggataatcaacaaaagtttgttttataaaagttttatacgtttgatttgtctttaatttaattttttaattttcagagcatcattcttcaagacaactaaaaaatcatttccaatgtttccttatatcgaagaaaaagtcaagtgggatgattatggagaagttattaaaccagaagactacactgtgatttcaaaaattgatttacggaaaggacaaaataaagatgaaccggtagttgtgaagaaacgagaagaagaagaagaagtttataatccgaacgatcatgttgaagaaatgccga