Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F09G8.4   

sjj_F09G8.4RNAiJA:F09G8.4
PCR_productsjj_F09G8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF09G8.4 Source_evidenceePCR921WS150 Sequence/Annotation Release
Overlaps_Gene F09G8.4 Source_evidenceePCR921WS150 Sequence/Annotation Release
Chunk_score Abs_score797
Max_abs_score797F09G8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII82611698262347
F09G8.6 Source_evidenceePCR56WS150 Sequence/Annotation Release
Overlaps_transcript F09G8.6 Source_evidenceePCR56WS150 Sequence/Annotation Release
F09G8.4 Source_evidenceePCR921WS150 Sequence/Annotation Release
WB_DNA_textsjj_F09G8.41179ttggtgtccatgcaacagataatgcaattgttgttttattctttgtcatcacttgtcttggaatcaatcgaatctttgtcattatcagaacatttcaagccaatggtcactgctacggacttccgaatatctcatatcgagaaatgaatcacagaatttcaaatgtaatgcgtcgaagtattccaattgttctaacaaactcccttatctgttcaacatgccttttcttagccggaggtgttcttccatatgtatctgtcagcatgccagcagttgaagtatttgcaagacatgctgggttggcaattcttatggatactgcattctatctccttgtaatgctaccactatttcaatatgatgcgagaagagaaatggtgagtacgttcattaatactgctgataatgcaatctttgtgaggtgaacactttgaaaataaacatttcagtctggaaaatgtgaaatctggccgtggtacgagctatcaaacgagtcaaaaattaatctatgcatggaagcagttgatggaaatcttcgaagcccagtggattggttcaagcttgcgatcgcccctttattgctcaaaaagatttgtagaatttggatagctacattcttctttgtttccctaattatagcatgctactgtactctgtgcctcgaatttggtttcaatcaagttatggctttttcagaggtttgtatttttattttttcccacttgaatggaagttttcagacaagttatctgacaaaacatttccaaaatatgaatgagaatttgaacattgggcctccgttatggtttgttgtagaaggtgatgtcaaatggcatgatccgaaaatgcaggttcgttgctttttttccgaatttctttgaaaataaagttcttataattttgcagaacaagttttgtacattagccggatgtgatgataattcaatgggaaataagatccgatcattggcatacgctgagaactacaaaggaaactatctacacggcgatgtaaatatttggctggattcatatcttcagttcatgcatcctcgaggttcatgctgcaaaatggatggaaaacaattttgtaggttatttgcaaggacaactagcgttcattctgataactttgataagggataagttatgaggtaaagaaaagagagttggggcatg